ID: 1183823950

View in Genome Browser
Species Human (GRCh38)
Location 22:40370573-40370595
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 540}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823950_1183823964 22 Left 1183823950 22:40370573-40370595 CCGCCCATGCCACGCCCCGCCAC 0: 1
1: 0
2: 3
3: 32
4: 540
Right 1183823964 22:40370618-40370640 GCGCTGACTGGGTGCGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 85
1183823950_1183823959 10 Left 1183823950 22:40370573-40370595 CCGCCCATGCCACGCCCCGCCAC 0: 1
1: 0
2: 3
3: 32
4: 540
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823950_1183823962 20 Left 1183823950 22:40370573-40370595 CCGCCCATGCCACGCCCCGCCAC 0: 1
1: 0
2: 3
3: 32
4: 540
Right 1183823962 22:40370616-40370638 GAGCGCTGACTGGGTGCGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 82
1183823950_1183823954 -10 Left 1183823950 22:40370573-40370595 CCGCCCATGCCACGCCCCGCCAC 0: 1
1: 0
2: 3
3: 32
4: 540
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823950_1183823963 21 Left 1183823950 22:40370573-40370595 CCGCCCATGCCACGCCCCGCCAC 0: 1
1: 0
2: 3
3: 32
4: 540
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823950_1183823960 11 Left 1183823950 22:40370573-40370595 CCGCCCATGCCACGCCCCGCCAC 0: 1
1: 0
2: 3
3: 32
4: 540
Right 1183823960 22:40370607-40370629 GGCGCCGCTGAGCGCTGACTGGG 0: 1
1: 0
2: 1
3: 7
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823950 Original CRISPR GTGGCGGGGCGTGGCATGGG CGG (reversed) Intronic