ID: 1183823951

View in Genome Browser
Species Human (GRCh38)
Location 22:40370576-40370598
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823951_1183823960 8 Left 1183823951 22:40370576-40370598 CCCATGCCACGCCCCGCCACGCG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1183823960 22:40370607-40370629 GGCGCCGCTGAGCGCTGACTGGG 0: 1
1: 0
2: 1
3: 7
4: 56
1183823951_1183823964 19 Left 1183823951 22:40370576-40370598 CCCATGCCACGCCCCGCCACGCG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1183823964 22:40370618-40370640 GCGCTGACTGGGTGCGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 85
1183823951_1183823963 18 Left 1183823951 22:40370576-40370598 CCCATGCCACGCCCCGCCACGCG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823951_1183823962 17 Left 1183823951 22:40370576-40370598 CCCATGCCACGCCCCGCCACGCG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1183823962 22:40370616-40370638 GAGCGCTGACTGGGTGCGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 82
1183823951_1183823959 7 Left 1183823951 22:40370576-40370598 CCCATGCCACGCCCCGCCACGCG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823951 Original CRISPR CGCGTGGCGGGGCGTGGCAT GGG (reversed) Intronic