ID: 1183823954

View in Genome Browser
Species Human (GRCh38)
Location 22:40370586-40370608
Sequence GCCCCGCCACGCGTGCGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823945_1183823954 8 Left 1183823945 22:40370555-40370577 CCCCAGCATGACCCGCGGCCGCC 0: 1
1: 0
2: 1
3: 12
4: 117
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823949_1183823954 -4 Left 1183823949 22:40370567-40370589 CCGCGGCCGCCCATGCCACGCCC 0: 1
1: 0
2: 5
3: 23
4: 317
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823946_1183823954 7 Left 1183823946 22:40370556-40370578 CCCAGCATGACCCGCGGCCGCCC 0: 1
1: 0
2: 3
3: 6
4: 127
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823950_1183823954 -10 Left 1183823950 22:40370573-40370595 CCGCCCATGCCACGCCCCGCCAC 0: 1
1: 0
2: 3
3: 32
4: 540
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823947_1183823954 6 Left 1183823947 22:40370557-40370579 CCAGCATGACCCGCGGCCGCCCA 0: 1
1: 0
2: 2
3: 8
4: 100
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823944_1183823954 9 Left 1183823944 22:40370554-40370576 CCCCCAGCATGACCCGCGGCCGC 0: 1
1: 0
2: 0
3: 13
4: 106
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823948_1183823954 -3 Left 1183823948 22:40370566-40370588 CCCGCGGCCGCCCATGCCACGCC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823954 Original CRISPR GCCCCGCCACGCGTGCGCTT AGG Intronic