ID: 1183823954

View in Genome Browser
Species Human (GRCh38)
Location 22:40370586-40370608
Sequence GCCCCGCCACGCGTGCGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823944_1183823954 9 Left 1183823944 22:40370554-40370576 CCCCCAGCATGACCCGCGGCCGC 0: 1
1: 0
2: 0
3: 13
4: 106
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823947_1183823954 6 Left 1183823947 22:40370557-40370579 CCAGCATGACCCGCGGCCGCCCA 0: 1
1: 0
2: 2
3: 8
4: 100
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823950_1183823954 -10 Left 1183823950 22:40370573-40370595 CCGCCCATGCCACGCCCCGCCAC 0: 1
1: 0
2: 3
3: 32
4: 540
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823949_1183823954 -4 Left 1183823949 22:40370567-40370589 CCGCGGCCGCCCATGCCACGCCC 0: 1
1: 0
2: 5
3: 23
4: 317
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823946_1183823954 7 Left 1183823946 22:40370556-40370578 CCCAGCATGACCCGCGGCCGCCC 0: 1
1: 0
2: 3
3: 6
4: 127
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823948_1183823954 -3 Left 1183823948 22:40370566-40370588 CCCGCGGCCGCCCATGCCACGCC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823945_1183823954 8 Left 1183823945 22:40370555-40370577 CCCCAGCATGACCCGCGGCCGCC 0: 1
1: 0
2: 1
3: 12
4: 117
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823954 Original CRISPR GCCCCGCCACGCGTGCGCTT AGG Intronic
900312966 1:2043338-2043360 GCCCTGCCACTCCTGCGCTGCGG - Intergenic
901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG + Intronic
902465291 1:16613609-16613631 GCCCCGCCGCGCCTGCGCCTTGG - Intergenic
903155508 1:21440045-21440067 GCCCCGCCGCGCCTGCGCCTTGG + Intergenic
913600176 1:120414996-120415018 GCCCCGCTGCGCCTGCGCCTTGG + Intergenic
914086884 1:144461668-144461690 GCCCCGCTGCGCCTGCGCCTTGG - Intronic
914311727 1:146472545-146472567 GCCCCGCTGCGCCTGCGCCTTGG + Intergenic
914590688 1:149103560-149103582 GCCCCGCTGCGCCTGCGCCTTGG - Intronic
918299143 1:183186345-183186367 GCCCCGCCATGCCTGCGCTCTGG + Exonic
924801516 1:247332007-247332029 GCCCCGCTCCGCGCGCGCCTGGG + Intergenic
1064016037 10:11773102-11773124 GCCCCGCCTCCAGTGCGCTGAGG + Intergenic
1096533933 12:52258786-52258808 GCCCCGCTGCCCGTGCGCTGCGG + Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1110436159 13:75480963-75480985 GCTCCTCCACGCGTGCTCCTTGG + Intronic
1113752502 13:112785986-112786008 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752519 13:112786109-112786131 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752535 13:112786232-112786254 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752551 13:112786355-112786377 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1113752568 13:112786478-112786500 GCCCGTCCACGCGTGTGCCTGGG - Intronic
1113752585 13:112786601-112786623 GCCCGTCCACGCGTGTGCCTGGG - Intronic
1113752601 13:112786724-112786746 GCCCGTCCACGCGTGTGCGTGGG - Intronic
1128119148 15:65133276-65133298 GGCCCGGCATGCGTGCGCTGGGG + Exonic
1131829660 15:96345934-96345956 TCCCGGCCACGCCTGCGATTTGG - Intergenic
1132652440 16:1027699-1027721 CGCCCGGCCCGCGTGCGCTTAGG - Intergenic
1132983057 16:2749150-2749172 GCCCCACCATGCCTGCGCTGAGG + Intergenic
1143164113 17:4889472-4889494 GCCCAGCCCCGCGGGCCCTTGGG + Intronic
1150416558 17:64993487-64993509 GCCCCTCCACGTGTGCCCCTTGG - Intergenic
1150795101 17:68230409-68230431 GCCCCTCCATGCGTGCCCCTTGG + Intergenic
1152799207 17:82323216-82323238 GCCCCGACACACCTGCGCTCTGG - Intronic
1158954129 18:62523492-62523514 GCCCGGCCGCGCGTCCGCCTCGG - Exonic
1161410622 19:4115249-4115271 GCCCAGCCACGCCTGCCCTCAGG + Intronic
1163471140 19:17497579-17497601 ACCCCGCCCTGCGTGCGCCTTGG - Intronic
1164388036 19:27793693-27793715 GCCCCTCCACGCGTCCACTGCGG - Intergenic
1164594743 19:29525785-29525807 GCCCCGCCCCGCACCCGCTTGGG - Intergenic
940987439 2:160062945-160062967 GCTCCGCGACGCAGGCGCTTTGG + Intergenic
1180078428 21:45475096-45475118 GCCCAGCCGGGCGTGCGCTGGGG + Intronic
1182586746 22:31347689-31347711 GCCCAGCCACGCGCGCCCTGAGG + Intergenic
1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG + Intronic
951906665 3:27713798-27713820 GCCCCGGCACGAGTTCGCTCTGG - Intergenic
969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG + Intronic
987405331 5:17518717-17518739 GACCCGCAACGCGTGCTCTCGGG - Intergenic
987405776 5:17522151-17522173 GACCCGCAACGCGTGCTCTCGGG - Intergenic
987406223 5:17525585-17525607 GACCCGCAACGCGTGCTCTCGGG - Intergenic
987406669 5:17529019-17529041 GACCCGCAACGCGTGCTCTCGGG - Intergenic
987407476 5:17585386-17585408 GACCCGCAACGCGTGCTCTCGGG + Intergenic
987408175 5:17590588-17590610 GACCCGCAACGCGTGCTCTCGGG + Intergenic
987408622 5:17594022-17594044 GACCCGCAACGCGTGCTCTCGGG + Intergenic
987409078 5:17597456-17597478 GACCCGCAACGCGTGCTCTCGGG + Intergenic
987412918 5:17632438-17632460 GACCCGCAATGCGTGCTCTTGGG - Intergenic
998461748 5:142314897-142314919 GCCCCGCCCCGGGTCCGCTTTGG + Exonic
1002296219 5:178232686-178232708 CCACCGCAACGCGGGCGCTTCGG - Exonic
1002559596 5:180072196-180072218 GCCCTGGCACGCATGCGCTCGGG - Intergenic
1006185357 6:32178551-32178573 GCCCCGCCCCGCTCGCGATTTGG - Exonic
1006933112 6:37699098-37699120 GCCCCTCCCCGCGGGCGTTTGGG - Intronic
1013225943 6:108119474-108119496 GCCCTGCCACGCCTGCGCTGGGG - Intronic
1022873785 7:34506833-34506855 GCCCCACCACGCGTCAGCTGTGG - Intergenic
1032514361 7:132495757-132495779 GCCCCACCATGGGTGAGCTTGGG - Intronic
1039572845 8:38601139-38601161 GCCCCGCCCCGCTCGCGATTTGG + Intergenic
1055757480 9:79571783-79571805 GGCCCGCCATGCGAGCGCTCTGG - Intronic
1056747739 9:89318767-89318789 GCCCCGCCTCGGGTCCGCCTTGG + Intronic
1057546053 9:96021198-96021220 GCCCCGCCGCGGGTGCCCTTCGG - Intergenic
1062032172 9:134366610-134366632 GCCCCTCCACTAGTGGGCTTTGG + Intronic
1062252323 9:135604607-135604629 GCACGGCCAGGGGTGCGCTTTGG - Intergenic
1190714834 X:53094339-53094361 GCCCCACCCCTCGCGCGCTTCGG - Intergenic