ID: 1183823956

View in Genome Browser
Species Human (GRCh38)
Location 22:40370588-40370610
Sequence CGCCTAAGCGCACGCGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823956_1183823965 27 Left 1183823956 22:40370588-40370610 CCCGCCACGCGTGCGCTTAGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1183823965 22:40370638-40370660 GGGAAGCTGCTAACCCGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1183823956_1183823964 7 Left 1183823956 22:40370588-40370610 CCCGCCACGCGTGCGCTTAGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1183823964 22:40370618-40370640 GCGCTGACTGGGTGCGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 85
1183823956_1183823959 -5 Left 1183823956 22:40370588-40370610 CCCGCCACGCGTGCGCTTAGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823956_1183823962 5 Left 1183823956 22:40370588-40370610 CCCGCCACGCGTGCGCTTAGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1183823962 22:40370616-40370638 GAGCGCTGACTGGGTGCGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 82
1183823956_1183823963 6 Left 1183823956 22:40370588-40370610 CCCGCCACGCGTGCGCTTAGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823956_1183823960 -4 Left 1183823956 22:40370588-40370610 CCCGCCACGCGTGCGCTTAGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1183823960 22:40370607-40370629 GGCGCCGCTGAGCGCTGACTGGG 0: 1
1: 0
2: 1
3: 7
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823956 Original CRISPR CGCCTAAGCGCACGCGTGGC GGG (reversed) Intronic