ID: 1183823957

View in Genome Browser
Species Human (GRCh38)
Location 22:40370589-40370611
Sequence GCGCCTAAGCGCACGCGTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 20}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823957_1183823962 4 Left 1183823957 22:40370589-40370611 CCGCCACGCGTGCGCTTAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1183823962 22:40370616-40370638 GAGCGCTGACTGGGTGCGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 82
1183823957_1183823965 26 Left 1183823957 22:40370589-40370611 CCGCCACGCGTGCGCTTAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1183823965 22:40370638-40370660 GGGAAGCTGCTAACCCGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1183823957_1183823963 5 Left 1183823957 22:40370589-40370611 CCGCCACGCGTGCGCTTAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823957_1183823959 -6 Left 1183823957 22:40370589-40370611 CCGCCACGCGTGCGCTTAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823957_1183823964 6 Left 1183823957 22:40370589-40370611 CCGCCACGCGTGCGCTTAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1183823964 22:40370618-40370640 GCGCTGACTGGGTGCGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 85
1183823957_1183823960 -5 Left 1183823957 22:40370589-40370611 CCGCCACGCGTGCGCTTAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1183823960 22:40370607-40370629 GGCGCCGCTGAGCGCTGACTGGG 0: 1
1: 0
2: 1
3: 7
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823957 Original CRISPR GCGCCTAAGCGCACGCGTGG CGG (reversed) Exonic