ID: 1183823958

View in Genome Browser
Species Human (GRCh38)
Location 22:40370592-40370614
Sequence GCGGCGCCTAAGCGCACGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 27}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823958_1183823960 -8 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823960 22:40370607-40370629 GGCGCCGCTGAGCGCTGACTGGG 0: 1
1: 0
2: 1
3: 7
4: 56
1183823958_1183823965 23 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823965 22:40370638-40370660 GGGAAGCTGCTAACCCGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1183823958_1183823964 3 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823964 22:40370618-40370640 GCGCTGACTGGGTGCGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 85
1183823958_1183823959 -9 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823958_1183823966 28 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823966 22:40370643-40370665 GCTGCTAACCCGACCCGGATTGG 0: 1
1: 0
2: 0
3: 1
4: 14
1183823958_1183823963 2 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823958_1183823962 1 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823962 22:40370616-40370638 GAGCGCTGACTGGGTGCGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823958 Original CRISPR GCGGCGCCTAAGCGCACGCG TGG (reversed) Exonic