ID: 1183823959

View in Genome Browser
Species Human (GRCh38)
Location 22:40370606-40370628
Sequence AGGCGCCGCTGAGCGCTGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823949_1183823959 16 Left 1183823949 22:40370567-40370589 CCGCGGCCGCCCATGCCACGCCC 0: 1
1: 0
2: 5
3: 23
4: 317
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823944_1183823959 29 Left 1183823944 22:40370554-40370576 CCCCCAGCATGACCCGCGGCCGC 0: 1
1: 0
2: 0
3: 13
4: 106
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823946_1183823959 27 Left 1183823946 22:40370556-40370578 CCCAGCATGACCCGCGGCCGCCC 0: 1
1: 0
2: 3
3: 6
4: 127
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823953_1183823959 1 Left 1183823953 22:40370582-40370604 CCACGCCCCGCCACGCGTGCGCT 0: 1
1: 0
2: 1
3: 21
4: 217
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823951_1183823959 7 Left 1183823951 22:40370576-40370598 CCCATGCCACGCCCCGCCACGCG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823955_1183823959 -4 Left 1183823955 22:40370587-40370609 CCCCGCCACGCGTGCGCTTAGGC 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823958_1183823959 -9 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823956_1183823959 -5 Left 1183823956 22:40370588-40370610 CCCGCCACGCGTGCGCTTAGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823948_1183823959 17 Left 1183823948 22:40370566-40370588 CCCGCGGCCGCCCATGCCACGCC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823952_1183823959 6 Left 1183823952 22:40370577-40370599 CCATGCCACGCCCCGCCACGCGT 0: 1
1: 0
2: 2
3: 12
4: 219
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823947_1183823959 26 Left 1183823947 22:40370557-40370579 CCAGCATGACCCGCGGCCGCCCA 0: 1
1: 0
2: 2
3: 8
4: 100
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823957_1183823959 -6 Left 1183823957 22:40370589-40370611 CCGCCACGCGTGCGCTTAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823950_1183823959 10 Left 1183823950 22:40370573-40370595 CCGCCCATGCCACGCCCCGCCAC 0: 1
1: 0
2: 3
3: 32
4: 540
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823945_1183823959 28 Left 1183823945 22:40370555-40370577 CCCCAGCATGACCCGCGGCCGCC 0: 1
1: 0
2: 1
3: 12
4: 117
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823959 Original CRISPR AGGCGCCGCTGAGCGCTGAC TGG Exonic