ID: 1183823961

View in Genome Browser
Species Human (GRCh38)
Location 22:40370611-40370633
Sequence CGCACCCAGTCAGCGCTCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823961_1183823966 9 Left 1183823961 22:40370611-40370633 CCGCTGAGCGCTGACTGGGTGCG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1183823966 22:40370643-40370665 GCTGCTAACCCGACCCGGATTGG 0: 1
1: 0
2: 0
3: 1
4: 14
1183823961_1183823970 20 Left 1183823961 22:40370611-40370633 CCGCTGAGCGCTGACTGGGTGCG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1183823970 22:40370654-40370676 GACCCGGATTGGCGCTGAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 50
1183823961_1183823975 29 Left 1183823961 22:40370611-40370633 CCGCTGAGCGCTGACTGGGTGCG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1183823975 22:40370663-40370685 TGGCGCTGAGGTGGCCCGTGGGG 0: 1
1: 0
2: 1
3: 8
4: 151
1183823961_1183823974 28 Left 1183823961 22:40370611-40370633 CCGCTGAGCGCTGACTGGGTGCG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1183823974 22:40370662-40370684 TTGGCGCTGAGGTGGCCCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1183823961_1183823968 17 Left 1183823961 22:40370611-40370633 CCGCTGAGCGCTGACTGGGTGCG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1183823968 22:40370651-40370673 CCCGACCCGGATTGGCGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 43
1183823961_1183823973 27 Left 1183823961 22:40370611-40370633 CCGCTGAGCGCTGACTGGGTGCG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1183823973 22:40370661-40370683 ATTGGCGCTGAGGTGGCCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 82
1183823961_1183823965 4 Left 1183823961 22:40370611-40370633 CCGCTGAGCGCTGACTGGGTGCG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1183823965 22:40370638-40370660 GGGAAGCTGCTAACCCGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823961 Original CRISPR CGCACCCAGTCAGCGCTCAG CGG (reversed) Exonic