ID: 1183823963

View in Genome Browser
Species Human (GRCh38)
Location 22:40370617-40370639
Sequence AGCGCTGACTGGGTGCGAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 58}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823949_1183823963 27 Left 1183823949 22:40370567-40370589 CCGCGGCCGCCCATGCCACGCCC 0: 1
1: 0
2: 5
3: 23
4: 317
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823952_1183823963 17 Left 1183823952 22:40370577-40370599 CCATGCCACGCCCCGCCACGCGT 0: 1
1: 0
2: 2
3: 12
4: 219
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823948_1183823963 28 Left 1183823948 22:40370566-40370588 CCCGCGGCCGCCCATGCCACGCC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823957_1183823963 5 Left 1183823957 22:40370589-40370611 CCGCCACGCGTGCGCTTAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823953_1183823963 12 Left 1183823953 22:40370582-40370604 CCACGCCCCGCCACGCGTGCGCT 0: 1
1: 0
2: 1
3: 21
4: 217
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823951_1183823963 18 Left 1183823951 22:40370576-40370598 CCCATGCCACGCCCCGCCACGCG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823955_1183823963 7 Left 1183823955 22:40370587-40370609 CCCCGCCACGCGTGCGCTTAGGC 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823956_1183823963 6 Left 1183823956 22:40370588-40370610 CCCGCCACGCGTGCGCTTAGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823958_1183823963 2 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823950_1183823963 21 Left 1183823950 22:40370573-40370595 CCGCCCATGCCACGCCCCGCCAC 0: 1
1: 0
2: 3
3: 32
4: 540
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823963 Original CRISPR AGCGCTGACTGGGTGCGAGT GGG Exonic