ID: 1183823965

View in Genome Browser
Species Human (GRCh38)
Location 22:40370638-40370660
Sequence GGGAAGCTGCTAACCCGACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823957_1183823965 26 Left 1183823957 22:40370589-40370611 CCGCCACGCGTGCGCTTAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1183823965 22:40370638-40370660 GGGAAGCTGCTAACCCGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1183823955_1183823965 28 Left 1183823955 22:40370587-40370609 CCCCGCCACGCGTGCGCTTAGGC 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1183823965 22:40370638-40370660 GGGAAGCTGCTAACCCGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1183823956_1183823965 27 Left 1183823956 22:40370588-40370610 CCCGCCACGCGTGCGCTTAGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1183823965 22:40370638-40370660 GGGAAGCTGCTAACCCGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1183823958_1183823965 23 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823965 22:40370638-40370660 GGGAAGCTGCTAACCCGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1183823961_1183823965 4 Left 1183823961 22:40370611-40370633 CCGCTGAGCGCTGACTGGGTGCG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1183823965 22:40370638-40370660 GGGAAGCTGCTAACCCGACCCGG 0: 1
1: 0
2: 1
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823965 Original CRISPR GGGAAGCTGCTAACCCGACC CGG Exonic