ID: 1183823966

View in Genome Browser
Species Human (GRCh38)
Location 22:40370643-40370665
Sequence GCTGCTAACCCGACCCGGAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 14}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823961_1183823966 9 Left 1183823961 22:40370611-40370633 CCGCTGAGCGCTGACTGGGTGCG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1183823966 22:40370643-40370665 GCTGCTAACCCGACCCGGATTGG 0: 1
1: 0
2: 0
3: 1
4: 14
1183823958_1183823966 28 Left 1183823958 22:40370592-40370614 CCACGCGTGCGCTTAGGCGCCGC 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1183823966 22:40370643-40370665 GCTGCTAACCCGACCCGGATTGG 0: 1
1: 0
2: 0
3: 1
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823966 Original CRISPR GCTGCTAACCCGACCCGGAT TGG Exonic