ID: 1183824693

View in Genome Browser
Species Human (GRCh38)
Location 22:40376398-40376420
Sequence GCAACTCATGAGATTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1211
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 1149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183824693_1183824696 13 Left 1183824693 22:40376398-40376420 CCTGCTTTAATCTCATGAGTTGC 0: 1
1: 0
2: 2
3: 59
4: 1149
Right 1183824696 22:40376434-40376456 GCATGCCACTGCACCCGGCCTGG 0: 1
1: 1
2: 53
3: 635
4: 3017
1183824693_1183824695 8 Left 1183824693 22:40376398-40376420 CCTGCTTTAATCTCATGAGTTGC 0: 1
1: 0
2: 2
3: 59
4: 1149
Right 1183824695 22:40376429-40376451 CAGGTGCATGCCACTGCACCCGG 0: 40
1: 319
2: 3006
3: 16807
4: 56864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183824693 Original CRISPR GCAACTCATGAGATTAAAGC AGG (reversed) Intronic
900783913 1:4635737-4635759 GCTACTCAGGAGACTGAAGCAGG - Intergenic
900987104 1:6079405-6079427 GCTACTCAGGAGACTGAAGCAGG + Intronic
901362632 1:8715790-8715812 GCTACTCAGGAGACTAAGGCAGG + Intronic
901694695 1:10998109-10998131 GCAACTCAGGAGGCTGAAGCAGG - Intergenic
902352734 1:15869978-15870000 GCTACTCAGGAGGCTAAAGCGGG - Intronic
902947067 1:19848966-19848988 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
902947985 1:19857077-19857099 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
902997664 1:20239349-20239371 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
903076201 1:20768726-20768748 GCTACTCAGGAGACTAAGGCAGG + Intronic
903981783 1:27194127-27194149 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
904085951 1:27908233-27908255 GCTACTCAGGAGACTATAGCAGG - Intronic
904140355 1:28348191-28348213 GCTACTCATGAGGTTGAGGCAGG + Intergenic
904172069 1:28598480-28598502 GCTACTCAGGAGGTTGAAGCAGG - Intronic
904513302 1:31032693-31032715 GCTACTCATGAGGCTAAAGCAGG + Intronic
904536891 1:31205418-31205440 GCTACTCAGGAGGCTAAAGCAGG - Intronic
905140257 1:35837992-35838014 GCTACTCAGGAGACTAAAGCGGG - Intronic
905142617 1:35860093-35860115 GCTACTCAGGAGACTGAAGCAGG - Intergenic
905279590 1:36840613-36840635 GCTACTCAGGAGACTAAGGCAGG + Intronic
905469918 1:38183990-38184012 GCTACTCAGGAGATTGAGGCAGG + Intergenic
905681427 1:39874775-39874797 GCTACTCAGGAGACTAAGGCAGG - Intronic
905830042 1:41058490-41058512 GCAACTCAGGAGGCTGAAGCAGG - Intronic
906007452 1:42488423-42488445 GCTACTCATGAGACTGAGGCAGG - Intronic
906026224 1:42676354-42676376 GCTACTCAGGAGGTTGAAGCAGG + Intronic
906443976 1:45877336-45877358 GCTACTCAGGAGATTGAGGCAGG - Intronic
906794032 1:48682518-48682540 GCTACTCAGGAGGTTGAAGCAGG - Intronic
906970031 1:50503083-50503105 GCTACTCAGGAGGCTAAAGCAGG - Intronic
907478420 1:54724375-54724397 GCTACTCAGGAGATTGAGGCAGG - Intronic
907542264 1:55226802-55226824 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
907671242 1:56476752-56476774 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
907894963 1:58679568-58679590 GCTACTCAGGAGACTGAAGCAGG - Intronic
908107601 1:60861247-60861269 GCTACTCAGGAGATTAAGGCAGG + Intergenic
908228748 1:62083234-62083256 GCTACTCAGGAGACTAAGGCAGG - Intronic
908233666 1:62130220-62130242 GCTACTCAAGAGACTGAAGCAGG + Intronic
908756108 1:67470276-67470298 GCTACTCAGGAGATTGAGGCAGG + Intergenic
908787221 1:67747229-67747251 GCTACTCAGGAGATTGAGGCAGG - Intronic
909242358 1:73230390-73230412 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
909446008 1:75749822-75749844 GCTACTCATGAGGCTAAGGCAGG - Intronic
909577582 1:77192021-77192043 GCTACTCAGGAGATTGAGGCAGG + Intronic
910184809 1:84526754-84526776 GCTACTCAGGAGACTGAAGCAGG + Intergenic
910271509 1:85400301-85400323 GCTACTCAGGAGATTGAGGCAGG - Intronic
910582071 1:88839670-88839692 GCTACTCAGGAGACTGAAGCAGG + Intergenic
910951902 1:92657549-92657571 GCTACTCAGGAGGCTAAAGCAGG + Intronic
910983636 1:92983135-92983157 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
911018051 1:93356351-93356373 GCTACTCATGAGGCTGAAGCAGG - Intronic
911727082 1:101252998-101253020 GCTACTCAGGAGGTCAAAGCGGG + Intergenic
912823452 1:112885396-112885418 GCTACTCAGGAGACTAAGGCAGG + Intergenic
912882569 1:113431204-113431226 GCTACTCAGGAGACTGAAGCTGG + Intronic
913247561 1:116883594-116883616 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
913373441 1:118126315-118126337 GCTACTCGGGAGACTAAAGCAGG - Intronic
913696306 1:121329097-121329119 GCTACTCAAGAGATTGAAGCAGG + Intronic
914141256 1:144950958-144950980 GCTACTCAAGAGATTGAAGCAGG - Intronic
914194069 1:145435408-145435430 GCTACTCCTGAGATTGAGGCAGG + Intergenic
914475401 1:148018305-148018327 GCTACTCCTGAGATTGAGGCAGG + Intergenic
914586803 1:149070207-149070229 GCAACTCAGGAGACTGAGGCAGG + Intronic
914871854 1:151481622-151481644 GCTACTCGGGAGACTAAAGCAGG + Intergenic
914905606 1:151741115-151741137 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
915197995 1:154204671-154204693 GCCACTCAGGAGACTGAAGCAGG - Intronic
915438923 1:155931673-155931695 GCTACTCAGGAGGTTAAAGCGGG - Intronic
916055243 1:161064644-161064666 GCTACTCAGGAGGCTAAAGCAGG + Intronic
916125610 1:161568287-161568309 GCAACTCAGGAGGCTGAAGCAGG - Intergenic
916135524 1:161650117-161650139 GCAACTCAGGAGGCTGAAGCAGG - Intronic
916230187 1:162534005-162534027 GCTACTCAGGAGACTAAGGCAGG + Intergenic
916964953 1:169928583-169928605 GCTACTCATGGGTTTGAAGCAGG + Intronic
917125906 1:171687132-171687154 GCAACTGATGAGATCAAGGAAGG + Intergenic
917129419 1:171725800-171725822 GCAACTCAGGGGGTTAAGGCAGG - Intronic
917458372 1:175205336-175205358 GCTACTCAGGAGACTGAAGCAGG + Intergenic
917538311 1:175890435-175890457 GCTACTCAGGAGATTGAGGCAGG + Intergenic
917752136 1:178063354-178063376 GCTACTCAGGAGACTGAAGCAGG + Intergenic
917883788 1:179364635-179364657 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
917990694 1:180375435-180375457 GCTACTCATGAGGCTGAAGCAGG - Intronic
918698690 1:187579625-187579647 GCTACTCAGGAGATTGAGGCAGG + Intergenic
918860796 1:189824514-189824536 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
918966380 1:191354945-191354967 GCTACTCAGGAGATTAATGCAGG - Intergenic
919006228 1:191902469-191902491 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
919099756 1:193080017-193080039 GCTACTCATGAGGTTGAGGCAGG + Intronic
919254298 1:195101023-195101045 GCTACTCAGGAGACTAAGGCAGG + Intergenic
919334339 1:196212887-196212909 GCAACTCAGGAGACTGAGGCAGG + Intergenic
919810831 1:201407929-201407951 GCTACTCAGGAGGTTGAAGCAGG + Exonic
919917692 1:202148965-202148987 GCTACTCAGGAGATTGAGGCAGG - Intronic
920483629 1:206347463-206347485 GCTACTCAAGAGATTGAAGCAGG + Intronic
921197130 1:212768929-212768951 GCTACTCAAGAGACTAAGGCAGG + Intronic
921338427 1:214110877-214110899 GAAACACATGAGGTTAAAGAGGG - Intergenic
921356873 1:214293162-214293184 GCTACTCAGGAGACTGAAGCGGG - Intronic
921437082 1:215136205-215136227 GCTACTCAGGAGATTGAGGCAGG - Intronic
921510944 1:216028274-216028296 GCTACTCAGGAGACTAAGGCAGG + Intronic
921587120 1:216960695-216960717 GCTACTCAGGAGATTAAGGCAGG - Intronic
921711520 1:218378085-218378107 GCTACTCAGGAGACTAAGGCAGG - Intronic
922118074 1:222633960-222633982 GCTACTCAGGAGACTGAAGCAGG - Intronic
922295468 1:224246140-224246162 GCTACTCAGGAGGCTAAAGCAGG - Intronic
922309536 1:224375209-224375231 GCAACTCTTGAGATGAAAGCAGG - Intronic
922425863 1:225492195-225492217 GCTACTCAGGAGACTGAAGCGGG - Exonic
922491948 1:226024882-226024904 GCTACTCAGGAGACTAAGGCAGG + Intergenic
922774800 1:228209727-228209749 GCTACTCAAGAGACTGAAGCAGG - Intronic
922810466 1:228412656-228412678 GCTACTCAGGAGGTTGAAGCAGG + Intronic
922944155 1:229496360-229496382 GCTACTCAGGAGACTAAGGCAGG + Intronic
923397691 1:233583415-233583437 GCAACTCAGGAGACTGAGGCAGG - Intergenic
923479311 1:234367947-234367969 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
923722136 1:236476078-236476100 GCAACTCAGGAGGCTGAAGCAGG + Intronic
923833144 1:237580265-237580287 GCTACTCAGGAGGTTGAAGCAGG - Intronic
923884268 1:238137723-238137745 GCAACTCAGGAGGCTAAGGCAGG + Intergenic
924103390 1:240626968-240626990 GCTACTCAAGAGATTGAAGTGGG + Intergenic
924258884 1:242209904-242209926 GCTACTCAGGAGATTGAGGCAGG - Intronic
924286403 1:242492408-242492430 GCTACTCAGGAGATTGAGGCAGG + Intronic
924529152 1:244878812-244878834 GCTACTCAGGAGGCTAAAGCGGG + Intergenic
924531077 1:244894463-244894485 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
924724927 1:246660611-246660633 GCTACTCAGGAGACTGAAGCAGG + Intronic
924810524 1:247397302-247397324 GCTACTCAGGAGGTTAAAGCAGG - Intergenic
924938762 1:248794784-248794806 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1062870699 10:901029-901051 GCTACTCATGAGGCTGAAGCAGG - Intronic
1063075149 10:2709174-2709196 GCTACTCAGGCGATTGAAGCAGG - Intergenic
1063442190 10:6081784-6081806 GCTACTCGGGAGATTAAGGCAGG - Intergenic
1063601109 10:7482267-7482289 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1063808074 10:9670415-9670437 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1064083896 10:12330690-12330712 GCGACTCAGGAGGTTGAAGCAGG - Intergenic
1064097396 10:12434080-12434102 GCAACTCAGGAGACTGAGGCAGG - Intronic
1064568188 10:16665053-16665075 GCTACTCAGGAGACTGAAGCAGG - Intronic
1064568344 10:16666875-16666897 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1064661473 10:17612024-17612046 GCTACTCATGAGGCTAATGCAGG + Intronic
1064688991 10:17894509-17894531 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1064852407 10:19723628-19723650 GCAACTCAGGAGACCAAGGCAGG + Intronic
1064983859 10:21190370-21190392 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1065033923 10:21618389-21618411 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1065182938 10:23145109-23145131 GCTACTCGGGAGATTAAGGCAGG - Intergenic
1065931823 10:30486501-30486523 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1066280739 10:33915775-33915797 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1066409412 10:35151618-35151640 GCACTTCAGGAGATCAAAGCAGG - Intronic
1066601705 10:37115476-37115498 GCTACTCAAGAGATTGAGGCAGG - Intergenic
1067001275 10:42616118-42616140 GCTACTCAGGAGACTAAGGCAGG + Intronic
1067298004 10:44985807-44985829 GGAGATCCTGAGATTAAAGCAGG - Intronic
1067489723 10:46687186-46687208 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1067604944 10:47653198-47653220 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1068145847 10:53069613-53069635 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1068512646 10:57985643-57985665 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1068640933 10:59406472-59406494 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1069447136 10:68483772-68483794 GCTACTCAGGAGACTGAAGCAGG - Intronic
1070084471 10:73223006-73223028 GCTACTCAGGGGACTAAAGCAGG + Intronic
1070141037 10:73738189-73738211 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1070211877 10:74331963-74331985 GCTACTCAGGAGACTGAAGCAGG - Intronic
1070572269 10:77649350-77649372 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1070623412 10:78031415-78031437 GCAACTCAGGAGGCTAAGGCAGG + Intergenic
1070873676 10:79781217-79781239 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
1071540439 10:86477941-86477963 GCTACTCAGGAGACTAAGGCAGG + Intronic
1071545896 10:86529117-86529139 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1071610822 10:87029806-87029828 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1071620499 10:87114611-87114633 GCTACTCAGGAGATTGAGGCAGG + Intronic
1071640608 10:87303367-87303389 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
1071654628 10:87434578-87434600 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
1072183892 10:93016243-93016265 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1072225159 10:93362058-93362080 GCTACTCAAGAGGTTAAGGCAGG - Intronic
1072653655 10:97315446-97315468 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1072669399 10:97418323-97418345 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1072763100 10:98074177-98074199 GAAACACATGATATTAAAGGTGG - Intergenic
1072803574 10:98409964-98409986 GCTACTCAGGAGATTGAGGCAGG + Intronic
1073394171 10:103204517-103204539 GCCACTCATGAGGCTAAAGTGGG + Intergenic
1073635164 10:105190508-105190530 GCCACTCAGGAGGCTAAAGCAGG - Intronic
1073760585 10:106624470-106624492 GCTACTCATGAGGATGAAGCAGG - Intronic
1073791783 10:106947732-106947754 GCTACTCAAGAGATTGAGGCAGG + Intronic
1074046170 10:109841257-109841279 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1074105575 10:110387530-110387552 GCAACTCAGGAGGTTGAGGCAGG + Intergenic
1074536781 10:114333697-114333719 GCTACTCAGGAGACTGAAGCAGG + Intronic
1075222224 10:120595061-120595083 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1075250207 10:120862249-120862271 GCAACTCAGGAGAGTGAGGCAGG - Intronic
1075760779 10:124854735-124854757 GCTACTCATGAGGCTAAGGCAGG - Intergenic
1076102393 10:127793504-127793526 GCTACTCAGGAGATTGAAGTGGG + Intergenic
1077267544 11:1659371-1659393 GCAACTCAGGAGGCTGAAGCAGG + Intergenic
1077432600 11:2523303-2523325 GCCACTCAGGAGATTGAGGCAGG - Intronic
1078193139 11:9109999-9110021 GCTACTCATGAGGCTAAGGCAGG + Intronic
1078223244 11:9369294-9369316 GCCACTCAGGAGGCTAAAGCAGG + Intergenic
1078277234 11:9861304-9861326 GCTACTCAGGAGGTTAAGGCGGG - Intronic
1078784471 11:14474982-14475004 GCTACTCAGGAGATTGAGGCAGG + Intronic
1079027243 11:16959263-16959285 GGAACTCATGAGAGCAAAGAAGG - Intronic
1079058157 11:17225330-17225352 GCTACTCATGAGGCTGAAGCAGG - Intronic
1079519045 11:21302947-21302969 GGAACTCAAGAGACTGAAGCGGG + Intronic
1080651623 11:34227160-34227182 GCTACTCAGGAGATTGAGGCAGG + Intronic
1080662514 11:34308757-34308779 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1080772161 11:35351745-35351767 GCTACTCAGGAGATTGAGGCAGG - Intronic
1081106156 11:39072292-39072314 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1081419673 11:42859978-42860000 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1081503502 11:43690484-43690506 GCAACTCAGGAGGCTAAGGCAGG - Intronic
1081519240 11:43865560-43865582 GCTACTCATGAGGCTAAGGCAGG + Intergenic
1081769439 11:45639302-45639324 GCTACTCATGAGATTGAGACAGG - Intergenic
1081891793 11:46548877-46548899 GCTACTCATCAGACTGAAGCAGG + Intronic
1081952802 11:47059990-47060012 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1082075891 11:47975870-47975892 GCAACTCAGGAGGCTGAAGCAGG - Intergenic
1082090147 11:48082353-48082375 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1082264815 11:50107262-50107284 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
1083042547 11:59701627-59701649 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
1083259905 11:61517263-61517285 GCCACTGATGAGACTAAAACTGG - Intronic
1083469374 11:62872712-62872734 GCTACTCAGGAGAATAAGGCAGG - Intronic
1083555397 11:63622090-63622112 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1083959291 11:66005291-66005313 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1084078566 11:66802262-66802284 GCTACTCAGGAGATTGAGGCAGG - Intronic
1084111845 11:67019358-67019380 GCTACTCAGGAGATTCAGGCAGG + Intronic
1084132510 11:67147428-67147450 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1084357030 11:68645927-68645949 GCTACTCATGAGGCTGAAGCAGG + Intergenic
1084610804 11:70201855-70201877 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1084988665 11:72901984-72902006 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1085250995 11:75143937-75143959 GCTACTCAGGAGACTGAAGCAGG + Intronic
1085675090 11:78509001-78509023 GCTACTCAAGAGACTGAAGCAGG + Intronic
1086236435 11:84636891-84636913 GCTACTCAGGAGGTTGAAGCAGG - Intronic
1086379967 11:86242435-86242457 GCTACTCAAGAGACTAAGGCAGG - Intergenic
1086784545 11:90951097-90951119 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1086893957 11:92290650-92290672 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1086984079 11:93229527-93229549 GCAACTCAGGAGTCTGAAGCAGG - Intergenic
1086998318 11:93385108-93385130 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1087782918 11:102319973-102319995 GCTACTCAGGAGACTGAAGCAGG - Intronic
1087924764 11:103906923-103906945 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1088199550 11:107316963-107316985 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
1088635129 11:111812453-111812475 GCTACTCAGGAGATTGAGGCAGG + Intronic
1088710684 11:112505795-112505817 GCTACTCAAGAGGCTAAAGCAGG - Intergenic
1088825902 11:113494285-113494307 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1089144620 11:116316462-116316484 GCTACTCATGAGGTTGAAGTGGG + Intergenic
1089173082 11:116528743-116528765 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1089482327 11:118816131-118816153 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1089536992 11:119166952-119166974 GCTACTCAGGAGACTGAAGCAGG - Intronic
1090787483 11:130062747-130062769 GCTACTCAGGAGACTGAAGCGGG + Intergenic
1090792659 11:130105302-130105324 GCTACTCAGGAGATTAAGGCTGG + Intronic
1090993582 11:131842897-131842919 GCTACTCAGGAGACTGAAGCAGG + Intronic
1091240698 11:134050407-134050429 GCTACTCCGGAGATTGAAGCAGG + Intergenic
1091398547 12:169243-169265 AAAGCTCATGAGATTAAAGAAGG - Intronic
1091927119 12:4361861-4361883 GCAACTCAGGAGGCTGAAGCAGG - Intergenic
1092354317 12:7782042-7782064 GCAACTCAGGAGGCTAAAGCAGG + Intergenic
1092381046 12:7997452-7997474 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1092820855 12:12352318-12352340 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1093070077 12:14699348-14699370 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1093295804 12:17389884-17389906 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1093457514 12:19379416-19379438 GCTACTCAGGAGACCAAAGCAGG + Intergenic
1093475670 12:19551797-19551819 GCTACTCAGGAGACTGAAGCAGG - Intronic
1093712897 12:22347729-22347751 GCTACTCAGGAGACTAAGGCAGG + Intronic
1093732928 12:22586531-22586553 GCTACTCATGAGACTAAGGTGGG - Intergenic
1093989216 12:25571473-25571495 GCTACTCATGAGGCTAAGGCAGG - Intronic
1094013239 12:25831295-25831317 GCCACTCAGGAGACTACAGCAGG - Intergenic
1094562233 12:31566206-31566228 GCAACTCAAGAGACTGAGGCAGG + Intronic
1094600368 12:31903786-31903808 GCTACTCAAGAGGTTAAGGCAGG - Intergenic
1094616656 12:32042304-32042326 GCTACTCAGGAGGCTAAAGCTGG - Intergenic
1095051528 12:37558941-37558963 GCTACTCATGAGGCTGAAGCAGG - Intergenic
1095758327 12:45796623-45796645 GCTACTCTGGAGACTAAAGCAGG - Intronic
1096008841 12:48195850-48195872 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1096385579 12:51192791-51192813 GCTACTCAGGAGACTGAAGCAGG + Intronic
1096388152 12:51208823-51208845 GCTACTCAGGAGATTGAGGCAGG + Intronic
1096527475 12:52219948-52219970 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1096531517 12:52245555-52245577 GGAACTCATGAGCGTGAAGCTGG + Exonic
1096566873 12:52489388-52489410 GCTACTCAGGAGACTGAAGCAGG - Intronic
1096697821 12:53361696-53361718 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1096909643 12:54970036-54970058 GCTACTCAGGAGATTGAGGCAGG - Intronic
1097161898 12:57052302-57052324 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1097309612 12:58104106-58104128 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
1097635744 12:62119959-62119981 GCTACTCAGGAGATTGAGGCAGG + Intronic
1097671650 12:62546640-62546662 GCTACTCAGGAGACTGAAGCAGG + Intronic
1097831673 12:64231187-64231209 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
1097897817 12:64843117-64843139 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1098003161 12:65967299-65967321 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1098008470 12:66023916-66023938 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1098727575 12:73987866-73987888 GCAACTCATGTTATCAAAGCCGG - Intergenic
1099209070 12:79762795-79762817 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1100246739 12:92765680-92765702 GCTACTCAGGAGGCTAAAGCTGG + Intronic
1100281046 12:93118548-93118570 GCAACTCAGGAGGCTGAAGCAGG - Intergenic
1100320075 12:93482695-93482717 GCTACTCATGAGGCTAAAGTGGG - Intronic
1100492393 12:95093562-95093584 GCTACTCAGGAGACTGAAGCAGG + Intronic
1100641603 12:96487067-96487089 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1100757851 12:97772374-97772396 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1100826135 12:98476356-98476378 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1100833875 12:98546593-98546615 GCTACTCAAGAGACTAAGGCAGG + Intronic
1100847394 12:98674105-98674127 GCTACTCAGGAGGTTGAAGCAGG - Intronic
1100943649 12:99753909-99753931 GCAACTCAGGAGGTTGAGGCAGG + Intronic
1101697392 12:107139421-107139443 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1101855039 12:108435170-108435192 AGAACTCAAGAGAATAAAGCAGG + Intergenic
1101976952 12:109367963-109367985 GCAACTCAGGAGGCTGAAGCGGG - Intronic
1102024024 12:109703239-109703261 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1102351621 12:112196700-112196722 GCTACTCAAGAGGCTAAAGCTGG - Intronic
1102544476 12:113644867-113644889 GCAACTCAGGAGGCTGAAGCAGG - Intergenic
1102847598 12:116203706-116203728 GCTACTCAGGAGATTGAGGCAGG + Intronic
1103295140 12:119879755-119879777 GCTACTCAGGAGGGTAAAGCAGG + Intergenic
1103353995 12:120306082-120306104 GCAACTCAGGAGGCTGAAGCAGG + Intronic
1104063567 12:125287977-125287999 GCTACTCAGGAGACTGAAGCAGG - Intronic
1104286284 12:127427750-127427772 GCAACTCAGGAGGTTGAGGCAGG + Intergenic
1105376853 13:19853711-19853733 GCTACTCAGGAAGTTAAAGCCGG - Intronic
1105388184 13:19951588-19951610 GCTACTCAAGAGATTGAGGCAGG + Intergenic
1105470116 13:20685766-20685788 GCTACTCAGGAGACTGAAGCAGG + Intronic
1105534938 13:21257205-21257227 GCCATTCATGAGATGAAAGTTGG - Intergenic
1105607061 13:21934799-21934821 GCAACTCAGGAGGTTGAGGCAGG - Intergenic
1106091451 13:26598980-26599002 GCTACTCATGAGGCTAAGGCAGG - Intronic
1106265758 13:28108214-28108236 GCAGCTCATGAGTTCTAAGCAGG - Intergenic
1106506442 13:30374866-30374888 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1106788649 13:33131828-33131850 GCCACTTATAAGATTGAAGCGGG + Intronic
1107526634 13:41239152-41239174 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1107634332 13:42377142-42377164 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1108339532 13:49484379-49484401 GCTACTCATGAGGCTGAAGCAGG - Intronic
1108401380 13:50047604-50047626 GCTACTCGGGAGACTAAAGCAGG - Intergenic
1108562423 13:51659036-51659058 GCTACTCAGGAGGTTAAGGCAGG - Intronic
1108915816 13:55609690-55609712 GCTACTCAAGAGATTGAGGCAGG + Intergenic
1109106638 13:58260393-58260415 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1109429904 13:62218226-62218248 GCTACTCAGGAGACTAAGGCGGG - Intergenic
1109547779 13:63849519-63849541 GCTACTCATGAGACTGAGGCAGG - Intergenic
1109610021 13:64752822-64752844 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1110023272 13:70503086-70503108 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1110256358 13:73437974-73437996 GTAACTCATGACATTACTGCTGG - Intergenic
1110325863 13:74214904-74214926 GCTACTCAAGAGGTTGAAGCAGG - Intergenic
1110577866 13:77080828-77080850 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1111329102 13:86740459-86740481 TCAAGTCATGATATAAAAGCAGG - Intergenic
1111534837 13:89589649-89589671 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1111585936 13:90284776-90284798 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
1111659325 13:91189862-91189884 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1111709139 13:91789099-91789121 GCTACTCAGGAGACTGAAGCAGG + Intronic
1112022321 13:95382348-95382370 GCTACTCAGGAGTCTAAAGCAGG - Intergenic
1112469429 13:99674261-99674283 GCTACTCAGGAGACTAAGGCAGG - Intronic
1112536427 13:100261475-100261497 GCTACTCAGGAGACTGAAGCAGG - Intronic
1112670107 13:101625662-101625684 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1114276200 14:21147326-21147348 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
1114385622 14:22251448-22251470 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1115173567 14:30535772-30535794 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1115237533 14:31222139-31222161 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1115303971 14:31915064-31915086 GCTACTCAAGAGACTAAGGCAGG - Intergenic
1115318796 14:32055975-32055997 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1115632737 14:35261615-35261637 GCTACTCAGGAGATTGAGGCAGG + Intronic
1115988635 14:39128600-39128622 GCTACTCAGGAGATTGAGGCAGG - Intronic
1116706007 14:48301966-48301988 GTAAATTATGAGATTAAAGCAGG + Intergenic
1116791926 14:49348363-49348385 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1116846114 14:49866591-49866613 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1116874052 14:50093913-50093935 GCTACTCGGGAGGTTAAAGCAGG - Intergenic
1116905019 14:50396072-50396094 GCAACTCAGGAGACTGAGGCAGG + Intronic
1117295653 14:54376818-54376840 GCTACTCAGGAGAATAAGGCAGG + Intergenic
1117382125 14:55174800-55174822 GCTACTCATGAGGCTAAGGCAGG - Intronic
1117733639 14:58748503-58748525 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1118556710 14:67031689-67031711 GCTACTCAGGAGATTGAGGCAGG - Intronic
1118644502 14:67824367-67824389 GCTACTCAGGAGATGGAAGCAGG - Intronic
1118815387 14:69309412-69309434 GCTACTCAGGAGATTGAAGCAGG - Intronic
1118954596 14:70468530-70468552 GCTACTCAGGAGATTGAAGCAGG + Intergenic
1119398078 14:74343236-74343258 GCTACTCAGGAGATTGAGGCAGG - Intronic
1119455251 14:74749546-74749568 GCTACTCACGAGGTTAAGGCTGG + Intergenic
1119792371 14:77363766-77363788 GCAACTCAGGAGACTGAGGCAGG - Intronic
1119865339 14:77968492-77968514 GCTACTCAGGAGATTGAAGCAGG + Intergenic
1120243904 14:81983377-81983399 GCCACTCAGGAGGCTAAAGCAGG - Intergenic
1120452127 14:84681502-84681524 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1120883720 14:89435258-89435280 GCTACTCATGAGGCTGAAGCAGG + Intronic
1121189270 14:92010416-92010438 GCAACTCAGGAGGTTGAGGCAGG + Intronic
1121406789 14:93723994-93724016 GCTACTCAGGAGGCTAAAGCTGG - Intronic
1121610417 14:95274865-95274887 GCTACTCAGGAGACTGAAGCAGG + Intronic
1121748708 14:96326804-96326826 GCAACTCAGGAGGCTGAAGCAGG - Intronic
1121770638 14:96533664-96533686 GCTACTCAGGAGACTAAGGCAGG - Intronic
1121793237 14:96714596-96714618 GCTACTCAAGAGGCTAAAGCGGG - Intergenic
1122385880 14:101347778-101347800 GCAACTCAGGAGACTGAGGCAGG - Intergenic
1122525687 14:102382179-102382201 GCTACTCAGGAGACTGAAGCAGG + Intronic
1122665132 14:103324380-103324402 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1122708327 14:103636331-103636353 GATACTCAGGAAATTAAAGCAGG - Intronic
1122751790 14:103939856-103939878 GCTACTCAGGAGGTTGAAGCAGG - Intronic
1202926751 14_KI270724v1_random:32568-32590 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1123712003 15:22995130-22995152 GCCACTCAGGAGACTAAGGCAGG + Intronic
1123908013 15:24939542-24939564 GCTACTCATGAGGTTGAGGCAGG - Intronic
1124188023 15:27546878-27546900 GCAACTCATGAGGCTGATGCAGG - Intergenic
1124586237 15:31011500-31011522 GCCACTCAAGAGGTTAAGGCAGG - Intronic
1125126964 15:36235568-36235590 GCTACTCAGGAGATTGAGGCCGG + Intergenic
1125162007 15:36655436-36655458 GCAACTCAGGAGGCTGAAGCAGG - Intronic
1125634648 15:41177163-41177185 GCTACTCACGAGGCTAAAGCAGG - Intergenic
1125701517 15:41689675-41689697 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1125961859 15:43836926-43836948 GCTACTCAAGAGGCTAAAGCAGG + Intronic
1125977606 15:43969191-43969213 GCTACTCAGGAGATTGAGGCAGG - Intronic
1126154633 15:45553935-45553957 GCTACTCAGGAGATTGAACCTGG + Intergenic
1126452229 15:48820827-48820849 GCAACTCAATAGATAAAGGCTGG - Intergenic
1126765788 15:52009882-52009904 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1127448607 15:59092886-59092908 GCTACTCAGGAGACTAAGGCAGG + Intronic
1127494830 15:59500407-59500429 GCTACTCAGGAGACTAAAGTTGG - Intronic
1127777187 15:62273484-62273506 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1127825964 15:62703212-62703234 GCTACTCAGGAGGTTAAGGCAGG - Intronic
1127879151 15:63140725-63140747 GCAACTCAGGAGGCTAAGGCAGG - Intronic
1128485241 15:68079576-68079598 GGAACTCAGGAGACTGAAGCAGG - Intronic
1128642076 15:69346926-69346948 GCTACTCAGGAGGTTGAAGCAGG - Intronic
1128869190 15:71139561-71139583 GCAACTCATGAAATTACTCCTGG - Intronic
1129090103 15:73140442-73140464 GCTACTCAGGAGACTGAAGCAGG + Intronic
1129378209 15:75148024-75148046 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
1129378310 15:75149059-75149081 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1129438933 15:75564987-75565009 GCTACTCAGGAGACTAAGGCAGG + Intronic
1130122938 15:81068012-81068034 GCTACTCAGGAGACTGAAGCAGG - Intronic
1130134440 15:81170225-81170247 GCTACTCATGAGACTGAAGCAGG + Intronic
1130219443 15:82006793-82006815 GGAACTCATGTGATTAGAGTGGG - Intergenic
1130748279 15:86680676-86680698 GCTACTCAAGAGACTAAGGCAGG - Intronic
1131028438 15:89165504-89165526 GCTACTCAGGAGACTAAGGCAGG + Intronic
1131124182 15:89844447-89844469 GCTACTCATGAGACTGAGGCAGG - Intronic
1131129077 15:89883505-89883527 GCTACTCATGTGGCTAAAGCAGG - Intronic
1131155190 15:90070705-90070727 GCTACACATGAGACTGAAGCAGG + Intronic
1131193292 15:90334666-90334688 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1131486712 15:92827046-92827068 GCGACTCAGGAGGCTAAAGCAGG - Intergenic
1131676836 15:94678403-94678425 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1131945571 15:97616617-97616639 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1132221052 15:100105797-100105819 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1132479910 16:162072-162094 GCTACTCAGGAGACTGAAGCAGG + Intronic
1132966177 16:2656008-2656030 GCAACTCAGGAGGCTAAGGCTGG + Intergenic
1133217541 16:4302368-4302390 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1133442375 16:5831599-5831621 GCTACTCAGGAGACTACAGCAGG - Intergenic
1133460304 16:5981578-5981600 GCTACTCATGAGGCTGAAGCAGG - Intergenic
1133672023 16:8032009-8032031 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1134192987 16:12136849-12136871 GCTACTCAGGAGACTGAAGCAGG - Intronic
1134469964 16:14515220-14515242 GCTACTCAGGAGATTGAGGCAGG - Intronic
1134628967 16:15743278-15743300 GCTACTCAGGAGATTGAGGCAGG - Intronic
1134748338 16:16605389-16605411 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1134843882 16:17423725-17423747 GCCACTCAGGAGACTGAAGCAGG - Intronic
1134997126 16:18748235-18748257 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1135189095 16:20340258-20340280 GCTACTCATGAGGCTAAAGCTGG + Intronic
1135514885 16:23123424-23123446 GCTACTCATGAGGCTGAAGCAGG + Intronic
1135651462 16:24210002-24210024 GCTACTCATGAGGCTAAAGTGGG + Intronic
1135767675 16:25191868-25191890 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1135989506 16:27209336-27209358 GCTACTCAGGAGATTAAAGGTGG - Intronic
1136061311 16:27728540-27728562 GCAACTCAGGAGGTTGAGGCAGG - Intronic
1136070230 16:27783035-27783057 GCAACCCCTGAGATAGAAGCAGG + Intergenic
1136157902 16:28397334-28397356 GCTACTCATGAGGCTAAGGCAGG - Intronic
1136205185 16:28717949-28717971 GCTACTCATGAGGCTAAGGCAGG + Intronic
1136414185 16:30093686-30093708 GCTACTCATGAGGTTGAGGCAGG - Intronic
1137020969 16:35427098-35427120 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1137026044 16:35475892-35475914 GCTACTCATGAGGCTAAGGCAGG + Intergenic
1137284898 16:47007364-47007386 GCTACTCATGAGGTTGAGGCAGG + Intergenic
1137313256 16:47287510-47287532 GCTACTCAGGAGGTTAAGGCAGG - Intronic
1137437253 16:48465954-48465976 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
1137654022 16:50144810-50144832 GCAACTCAGGAGACTGAGGCGGG - Intergenic
1137702561 16:50507448-50507470 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1138193131 16:55032945-55032967 GCTACTCAGGAGAGTGAAGCAGG + Intergenic
1138474454 16:57262621-57262643 GCTACTCATGAGGCTGAAGCAGG + Intronic
1138546689 16:57723614-57723636 GCTACTCAGGAGACTAAGGCAGG + Intronic
1138677503 16:58662532-58662554 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1139163558 16:64539596-64539618 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1139181949 16:64759229-64759251 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1139203580 16:65004259-65004281 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1139288950 16:65839937-65839959 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1139318536 16:66094107-66094129 GCTACTCAGGAGACTGAAGCGGG + Intergenic
1139510805 16:67427598-67427620 GCTACTCATGAGACTGAGGCAGG - Intergenic
1139645983 16:68330704-68330726 GCTACTCATGAGGCTGAAGCAGG - Intronic
1139735275 16:68982439-68982461 GCTACTCAGGAGACTGAAGCAGG - Intronic
1139875807 16:70145139-70145161 GCTACTCATGAGGCTGAAGCAGG + Intronic
1139904548 16:70354835-70354857 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1139933184 16:70546538-70546560 GCTACTCAGGAGACTAAGGCAGG + Intronic
1140023887 16:71265870-71265892 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1140071215 16:71651450-71651472 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1140085381 16:71791571-71791593 GCTACTCAGGAGATTGAGGCAGG + Intronic
1140359980 16:74335959-74335981 GCTACTCATGAGGCTGAAGCAGG - Intergenic
1140379681 16:74475043-74475065 GCAACTCAGGAGGCTAAGGCAGG + Intronic
1140589284 16:76332370-76332392 GCTACTCAGGAGACTAAGGCAGG - Intronic
1140710693 16:77674437-77674459 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1140939017 16:79703477-79703499 GCTACTCAGGAGATTGAAGAGGG - Intergenic
1141175994 16:81719612-81719634 GCTACTCGTGAGATTGAGGCAGG - Intergenic
1141448959 16:84084069-84084091 GCTACTCAGGAGATTGAGGCAGG - Intronic
1142041925 16:87899806-87899828 GCTACTCATGAGGTTGAGGCAGG + Intronic
1142515168 17:422971-422993 GCCACTCAGGAGGCTAAAGCAGG + Intronic
1142655241 17:1388035-1388057 GCTACTCAGGAGGTTAAGGCAGG - Intronic
1142724491 17:1802380-1802402 GCTACTCATGAGACTAAAGCAGG + Intronic
1142796754 17:2313622-2313644 GCAACTCAGGAGGTTGAGGCAGG + Intronic
1142958651 17:3537792-3537814 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1143079934 17:4374082-4374104 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1143809504 17:9459625-9459647 GCTACTCGGGAGGTTAAAGCAGG - Intronic
1144176979 17:12716876-12716898 GCTACTCATGGGACTAAGGCAGG + Intronic
1144411306 17:15004711-15004733 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1144805232 17:17961461-17961483 GCTACTCAGGAGACTAAGGCAGG + Intronic
1144936317 17:18901891-18901913 GCTACTCAGGAGACTAAGGCAGG - Intronic
1145267398 17:21386617-21386639 GCAACTCAGGAGACTGAGGCAGG - Intronic
1146020737 17:29276442-29276464 GCTACTCAGGAGACTAAGGCAGG - Intronic
1146114121 17:30119199-30119221 GCTACTCAGGAGATTGAAGCAGG - Intronic
1146143033 17:30386139-30386161 GCTACTCAGGAGATTGAGGCAGG - Intronic
1146177682 17:30676934-30676956 ACAACTCATGAGCTTAAAAGTGG - Intergenic
1146195348 17:30807642-30807664 GCTACTCAGGAGACTAAGGCAGG - Intronic
1146298722 17:31671741-31671763 GCAACACAGGAGACTGAAGCAGG + Intergenic
1146395755 17:32465230-32465252 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1146713383 17:35062289-35062311 GCAACTCAGGAGGCTAAGGCAGG + Intronic
1146792261 17:35758578-35758600 GCTACTCAGGAGATTGAGGCAGG + Intronic
1146942153 17:36850719-36850741 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1147431024 17:40370885-40370907 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1147576722 17:41605567-41605589 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1147963082 17:44179534-44179556 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1147995582 17:44358577-44358599 GCTACTCAGGAGACTAAGGCAGG + Intronic
1148373703 17:47122783-47122805 GCTACTCAGGAGACTGAAGCAGG - Intronic
1148654555 17:49273474-49273496 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1148658485 17:49307638-49307660 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1148661450 17:49336736-49336758 GCAACTCAGGAGGCTGAAGCAGG - Intronic
1148932830 17:51141053-51141075 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1149110999 17:53030457-53030479 GGAAGTAATGAGATTGAAGCTGG - Intergenic
1149431739 17:56599561-56599583 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1149488495 17:57064504-57064526 GCTACTCAGGAGGTCAAAGCAGG - Intergenic
1149576662 17:57718277-57718299 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1149876808 17:60242520-60242542 GCTACTCATGAGGCTAAGGCAGG - Intronic
1150040264 17:61852554-61852576 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1150322118 17:64223825-64223847 GCAACTCAGGAGGCTGAAGCAGG - Intronic
1150381677 17:64725606-64725628 GCTACTCAGGAGGCTAAAGCTGG + Intergenic
1150416347 17:64991754-64991776 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1150418412 17:65006567-65006589 GCAACTCAGGAGGCTGAAGCAGG - Intergenic
1150554311 17:66239939-66239961 GCTACTCAGGAGACTGAAGCAGG + Intronic
1150580301 17:66467667-66467689 GCTACTCAGGAGGTTGAAGCAGG - Intronic
1150697216 17:67416325-67416347 GCTACTCAGGAGGTTGAAGCAGG - Intronic
1150795331 17:68232382-68232404 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1151035970 17:70800399-70800421 TGAACTCATGAAATTAATGCAGG + Intergenic
1151151213 17:72088899-72088921 GCAACTAATCAGGGTAAAGCAGG + Intergenic
1151179058 17:72312533-72312555 GCTACTCAAGAGATTGAGGCAGG - Intergenic
1151521875 17:74636046-74636068 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1152986369 18:325079-325101 GCTACTCAGGAGACTAAAGTAGG + Intronic
1153974709 18:10258334-10258356 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
1154532892 18:15365419-15365441 GCCACTCAGGAGGTTGAAGCAGG + Intergenic
1155218979 18:23667481-23667503 GCAACTCAGGAGACTGAGGCAGG - Intergenic
1155630721 18:27888828-27888850 GCTACTCAGGATATTATAGCCGG + Intergenic
1155960208 18:31988202-31988224 GCTACTCAGGAGGGTAAAGCAGG - Intergenic
1155992874 18:32298756-32298778 CCAACTCATAAGATAAAATCAGG + Intronic
1156013198 18:32517446-32517468 GCTACTCAGGAGATTAAGGCAGG + Intergenic
1156208521 18:34912548-34912570 GCTACTCAAGAGGTTGAAGCAGG - Intergenic
1157647408 18:49289597-49289619 GCTACTCATGAGGCTGAAGCAGG + Intronic
1157660317 18:49435675-49435697 GCTACTCAGGAGATTGACGCAGG + Intronic
1157664572 18:49475064-49475086 GCTACTCAGGAGACTAAAGTGGG - Intergenic
1157699324 18:49750878-49750900 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1158356008 18:56620078-56620100 GCTACTCAGGAGACTGAAGCAGG - Intronic
1158439763 18:57465272-57465294 GCTACTCAGGAGACTGAAGCAGG - Intronic
1158448441 18:57541887-57541909 GCAACTCAGGAAACTGAAGCAGG + Intergenic
1158970834 18:62664970-62664992 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1159008274 18:63033526-63033548 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1160158229 18:76450167-76450189 ACAACTCATGAAACTAAAGGGGG + Intronic
1160614478 18:80114079-80114101 GCTACTCATGAGGTTGAGGCAGG + Intronic
1160749912 19:728890-728912 GCTACTCATGAGACTGAGGCAGG + Intronic
1160886088 19:1348974-1348996 GCTACTCATGAGGCTGAAGCAGG - Intergenic
1160957916 19:1702353-1702375 GCTACTCAGGAGGTTGAAGCGGG + Intergenic
1161343436 19:3754776-3754798 GCTACTCATGAGACTGAGGCAGG - Intronic
1161415977 19:4146621-4146643 GCAACTCAGGAGGGTAAAGCAGG - Intergenic
1161549963 19:4907219-4907241 GCTACTCAGGAGATTGAGGCAGG - Intronic
1161694866 19:5760799-5760821 GCAACTCAGGAGACTGAGGCAGG + Intronic
1161717975 19:5887595-5887617 GCTACTCAGGAGACTAAGGCAGG - Intronic
1161799565 19:6409269-6409291 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1161838723 19:6665518-6665540 GCTACTCAGGAGACTGAAGCAGG - Intronic
1162055965 19:8064274-8064296 GCTACTCAGGAGAGTGAAGCAGG - Intronic
1162253403 19:9466232-9466254 GCTACTCAGGAGACTAAAGCAGG + Intergenic
1162814059 19:13182602-13182624 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1162825141 19:13246735-13246757 GCTACTCAGGAGACTGAAGCAGG - Intronic
1162944882 19:14036945-14036967 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1163085627 19:14977667-14977689 GCCACTCAAGAGGCTAAAGCAGG + Intronic
1163090744 19:15018240-15018262 GCTACTCATGAGGCTGAAGCAGG + Intronic
1163110220 19:15155900-15155922 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
1163496733 19:17650400-17650422 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1163651100 19:18518387-18518409 GCTACTCAGGAGACTGAAGCAGG + Intronic
1163750112 19:19071752-19071774 GCTACTCAGGAGACTGAAGCAGG + Intronic
1163760615 19:19134488-19134510 GCTACTCAGGAGATTGAGGCAGG + Intronic
1163802909 19:19378259-19378281 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1163902393 19:20115983-20116005 GCTACTCAGGAGACTGAAGCAGG - Intronic
1164057967 19:21638544-21638566 GCTACTCATGAGACTGAGGCTGG + Intergenic
1164295691 19:23907739-23907761 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
1164310051 19:24037719-24037741 GCTACTCAGGAGGTTAAGGCAGG - Intronic
1165084206 19:33331751-33331773 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1165213982 19:34255951-34255973 GCTACTCGGGAGACTAAAGCAGG - Intronic
1165246714 19:34502064-34502086 GCTACTCGGGAGACTAAAGCAGG - Exonic
1165306872 19:35008215-35008237 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1165429845 19:35766432-35766454 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1165678499 19:37750192-37750214 GCTACTCAGGAGATTGAGGCAGG - Intronic
1166102854 19:40581401-40581423 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1166124619 19:40706569-40706591 GCTACTCAGGAGGTTAAGGCAGG - Intronic
1166186393 19:41141933-41141955 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1166779734 19:45335263-45335285 GCAACTCAGGAGGCTGAAGCAGG - Intronic
1166924331 19:46256112-46256134 GCTACTCAGGAGATGAAGGCAGG + Intergenic
1167075491 19:47246158-47246180 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1167168083 19:47812993-47813015 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1167239621 19:48335780-48335802 GCTACTCATGAGGCTGAAGCAGG + Intronic
1167279221 19:48556836-48556858 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1167431556 19:49458105-49458127 GCTACTCAGGAGATTGAGGCGGG + Intronic
1167442286 19:49515236-49515258 GCTACTCAGGAGACCAAAGCAGG - Intronic
1167516586 19:49926969-49926991 GCTACTCATGAGGCTAAGGCAGG - Intronic
1167692277 19:50993399-50993421 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1167899366 19:52607353-52607375 GCTACTCAGGAGGTTGAAGCAGG - Intronic
1167907280 19:52672120-52672142 GCTACTCAGGAGATTGAGGCAGG + Intronic
1168019816 19:53601126-53601148 GCTACTCAGGAGATGAAGGCAGG - Intronic
1168580953 19:57555448-57555470 GCTACTCAGGAGTTTGAAGCAGG - Intronic
1168631145 19:57957222-57957244 GCTACTCATGAGACTGAGGCAGG - Intergenic
925047484 2:784205-784227 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
925563595 2:5225263-5225285 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
926089488 2:10041320-10041342 GCTACTCAGGAGACTAAGGCAGG - Intergenic
926460550 2:13124599-13124621 GCTACTCAGGAGATTGAAGCAGG + Intergenic
927589239 2:24338743-24338765 ACAACTCAAGAGACTAAGGCAGG + Intronic
927762672 2:25773552-25773574 GCTACTCAGGAGACTGAAGCAGG + Intronic
927949961 2:27160726-27160748 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
927988852 2:27432989-27433011 GCTACTCAGGAGACTAAGGCAGG - Intronic
928170727 2:29001445-29001467 GCAACTCAGGAGACTGAGGCAGG - Intronic
928532692 2:32208240-32208262 GCTACTCAGGAGGTTGAAGCAGG - Intronic
928540573 2:32280006-32280028 GCTACTCAGGAGACTGAAGCGGG - Intronic
928564874 2:32535058-32535080 GCTACTCAGGAGACTGAAGCGGG + Intronic
928639742 2:33285558-33285580 GCAACTCAGGAGACTGAGGCAGG - Intronic
928967860 2:36995199-36995221 GCTACTCAGGAGGCTAAAGCAGG - Intronic
929017925 2:37519050-37519072 GCTACTCAGGAGACTAAAGAAGG - Intergenic
929106364 2:38369638-38369660 GCTACTCAGGAGACTAAGGCAGG + Intronic
929189958 2:39130677-39130699 GCTACTCAAGAGGCTAAAGCAGG + Intergenic
929418379 2:41766929-41766951 GCTACTCATGAGGCTGAAGCAGG + Intergenic
929550392 2:42886947-42886969 GCTACTCAGGAGACTAAGGCAGG + Intergenic
929635351 2:43513946-43513968 GCAACTCAGGAGGCTAAAGCAGG + Intronic
930077071 2:47414970-47414992 GCTACTCATGAGGTTGAAGCAGG - Intronic
930080619 2:47444889-47444911 GCTACTCAGGAGGTTGAAGCAGG - Intronic
930422303 2:51168552-51168574 GCAACTCAGGAGGTTGAAGCAGG - Intergenic
930789357 2:55307898-55307920 GCTACTCAGGAGGTTGAAGCAGG - Intronic
930828461 2:55717767-55717789 GCTACTCAGGAGACTGAAGCAGG - Intergenic
930965298 2:57316467-57316489 GTAACTAATGAAATTAAGGCAGG - Intergenic
931261021 2:60619518-60619540 GCTACTCAGGAGACTGAAGCAGG + Intergenic
931321630 2:61178326-61178348 GCTACTCATGAGGCTGAAGCAGG - Exonic
931449865 2:62359648-62359670 GCTACTCAGGAGACTAAGGCGGG - Intergenic
931883864 2:66594456-66594478 GCAACTCAAGAGACTGAGGCAGG - Intergenic
932131849 2:69194739-69194761 GCTACTCAGGAGACTGAAGCAGG + Intronic
932137373 2:69243030-69243052 GCATTTCATGTGATTAAACCAGG - Intronic
932587387 2:73039920-73039942 GCTACTCATGAGGTTGAGGCAGG - Intronic
932611669 2:73204164-73204186 GCTACTCAGGAGGCTAAAGCAGG + Intronic
933063350 2:77766899-77766921 GCTACTCAGGAGATTGAGGCAGG + Intergenic
933416445 2:81992541-81992563 GCTACTCATGAGGCTGAAGCAGG + Intergenic
933525104 2:83427701-83427723 GCTACTCAAGAGACTGAAGCAGG - Intergenic
933663388 2:84945603-84945625 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
933897839 2:86826931-86826953 GCTACTCAGGAGACTGAAGCAGG - Intronic
933953102 2:87347938-87347960 GCTACTCAGGAGATTAAGCCAGG + Intergenic
934560250 2:95309533-95309555 GCTACTCAGGAGGTTGAAGCAGG - Intronic
934586607 2:95504525-95504547 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
935267239 2:101405256-101405278 GCAACTCAGGAGCTTGAGGCAGG - Intronic
935412814 2:102783668-102783690 GCAACTCAGGAGACTGAAGTGGG + Intronic
935660191 2:105460067-105460089 TCAAAACAAGAGATTAAAGCAGG - Intergenic
935966931 2:108488015-108488037 GCTACTCAGGAGGTTGAAGCAGG - Intronic
935967975 2:108500399-108500421 GCTACTCAGGAGATTGAGGCAGG + Intronic
935998451 2:108800374-108800396 GCTACTCAGGAGATTAAGGCAGG - Intronic
936374430 2:111928595-111928617 GCTACTCAGGAGGTTGAAGCAGG - Intronic
936479573 2:112873456-112873478 GCTACTCATGAGGCTAAGGCAGG - Intergenic
936498535 2:113046319-113046341 GCTACTCAGGAGGTTGAAGCAGG - Intronic
936695472 2:114942159-114942181 GCTACTCGGGAGACTAAAGCAGG + Intronic
936718337 2:115216670-115216692 GCTACTCAGGAGGTTGAAGCAGG + Intronic
937410981 2:121675210-121675232 GCTACTCATGAGGCTGAAGCAGG + Intergenic
937449768 2:121992553-121992575 GCCACTCATGTCCTTAAAGCTGG - Intergenic
937851632 2:126641571-126641593 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
938383571 2:130849677-130849699 GCTACTCAGGAGATTGAGGCAGG - Intronic
938716091 2:134023227-134023249 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
938827048 2:135016143-135016165 GCTACTCAGGAGACTGAAGCAGG + Intronic
938869520 2:135460371-135460393 GCCACTCAGGAGACTGAAGCAGG - Intronic
939366170 2:141234486-141234508 GCTACTCAGGAGACTGAAGCAGG - Intronic
939463273 2:142525635-142525657 GCTACTCAGGAGACTGAAGCAGG + Intergenic
939658865 2:144862026-144862048 GCTACTCAAGAGACTGAAGCAGG + Intergenic
939966233 2:148613208-148613230 GCTACTCAGGAGACTGAAGCAGG - Intergenic
940548629 2:155122557-155122579 GCTACTCAGGAGACTGAAGCAGG + Intergenic
940599490 2:155840050-155840072 GCATCTCATTTGATGAAAGCAGG + Intergenic
940814684 2:158285174-158285196 GCAACTCAGGAGACTGAGGCAGG + Intronic
941898963 2:170659319-170659341 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
941911557 2:170770098-170770120 GCAACTCCAGAGATTAAATAGGG + Intergenic
941945882 2:171096644-171096666 GCTACTCAGGAGACTGAAGCAGG + Intronic
942346917 2:175013097-175013119 GCTACTCAGGAGACTGAAGCGGG - Intergenic
942625453 2:177895440-177895462 GCAACTCAGGAGACTGAGGCAGG + Intronic
943332790 2:186579942-186579964 GCCACTCAGGAGACTTAAGCAGG - Intergenic
943342803 2:186701026-186701048 GCTACTTAGGAGATTAAGGCAGG - Intronic
943467289 2:188243717-188243739 GCTATTCAGGAGACTAAAGCAGG + Intergenic
943745460 2:191457192-191457214 GCTACTCAGGAGATTGAGGCAGG - Intergenic
943871124 2:193001345-193001367 GCAACTCAGGAGGTTGAGGCAGG - Intergenic
944043839 2:195386548-195386570 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
944217452 2:197270350-197270372 GCAACTCATGAGATCTGAGGAGG + Intronic
944422814 2:199549125-199549147 GCTACTCATGAGGCTAAGGCAGG - Intergenic
944489633 2:200244830-200244852 GCTACTCATGAGGTTGAGGCAGG + Intergenic
944520356 2:200559670-200559692 GCTACTCAGGAGGCTAAAGCAGG - Intronic
944800759 2:203235767-203235789 GCAACTCAGGAGGCTGAAGCAGG - Intergenic
944930916 2:204518328-204518350 GCAATTCAGGAGACTGAAGCAGG - Intergenic
945138362 2:206655519-206655541 GCTACTCAAGAGACTGAAGCAGG - Intronic
945238721 2:207657002-207657024 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
945434899 2:209808449-209808471 GCTACTCAGGAGATTGAGGCAGG + Intronic
945928173 2:215827817-215827839 GCAACTCAGGAGGCTGAAGCAGG - Intergenic
946112837 2:217435207-217435229 GCAACTCAGGAGGTTGAGGCAGG + Intronic
946167684 2:217875337-217875359 GCAACCCATGGGCTTAGAGCAGG - Intronic
946264406 2:218526341-218526363 GCTACTCAGGAGACTGAAGCAGG - Intronic
946822202 2:223641919-223641941 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
947071177 2:226289517-226289539 GCTACTCAGGAGATTGAGGCAGG + Intergenic
947661411 2:231871872-231871894 GCTACTCAGGAGATTGAGGCAGG - Intergenic
947693465 2:232161882-232161904 GCTACTCAGGAGACTGAAGCAGG - Intronic
947695664 2:232185736-232185758 GCTACTCAGGAGGGTAAAGCAGG + Intronic
948507732 2:238441244-238441266 GCTACTCAGGAGACTGAAGCAGG - Intronic
948565906 2:238885982-238886004 GCTACTCAGGAGACTAAGGCAGG + Intronic
948664278 2:239525150-239525172 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1168770935 20:416265-416287 GCTACTCAGGAGATTGAGGCAGG - Intronic
1169223782 20:3843160-3843182 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1170469770 20:16656872-16656894 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1170674266 20:18464785-18464807 GCAACTCAGGAGGTTGAGGCAGG - Intronic
1170932116 20:20778418-20778440 GCTACTCAGGAGATTAAGGTGGG + Intergenic
1171432709 20:25094211-25094233 GCAACTCAGGAGGTTAAAGTGGG + Intergenic
1172078720 20:32320625-32320647 GCAACTCAGGAGGCTCAAGCAGG - Intronic
1172232847 20:33348567-33348589 GCAACTCAGGAATTTAAGGCTGG + Intergenic
1172281994 20:33714405-33714427 GCTACTCAGGAGACTGAAGCAGG + Intronic
1172566283 20:35933342-35933364 GCAACTCAGGAGTTTAAGGCAGG - Intronic
1172606727 20:36219128-36219150 GCCACTCATGAGATTCTAGCAGG - Intronic
1172670175 20:36629660-36629682 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1173708494 20:45133913-45133935 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1173837775 20:46136997-46137019 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1173907019 20:46636910-46636932 GCTACTCAGGAGACTAAGGCAGG - Intronic
1174429688 20:50458859-50458881 GCTACTCAAGAGGCTAAAGCAGG + Intergenic
1174607423 20:51770834-51770856 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
1174687634 20:52470683-52470705 GCCACTCAGGAGGCTAAAGCAGG + Intergenic
1174818840 20:53710316-53710338 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1175117475 20:56692966-56692988 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1175131493 20:56793112-56793134 GCTACTCAGGAGACCAAAGCAGG - Intergenic
1175343315 20:58249612-58249634 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1175851244 20:62094539-62094561 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
1176004304 20:62851918-62851940 GCTACTCAGGAGGTTGAAGCAGG - Intronic
1176764466 21:13002779-13002801 GCCACTCAGGAGGTTGAAGCAGG - Intergenic
1177562165 21:22770298-22770320 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1177572303 21:22902843-22902865 GCCACTCAGGAGGTTGAAGCAGG + Intergenic
1177689555 21:24487493-24487515 GCAACTTATGAGATTCACTCAGG - Intergenic
1178420043 21:32436173-32436195 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1178718630 21:34989118-34989140 GCTACTCAGGAGATTGAGGCAGG - Intronic
1180512412 22:16105617-16105639 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1180647843 22:17354445-17354467 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
1180694914 22:17745536-17745558 GCTACTCATGAGACTGAGGCGGG + Intronic
1181722584 22:24787241-24787263 GCCACTCAGGAGGTTAGAGCAGG - Intergenic
1181827865 22:25534098-25534120 GCTACTCAGGAGGTTTAAGCAGG - Intergenic
1182224134 22:28782548-28782570 GCTACTCAGGAGATTGAGGCAGG - Intronic
1182239242 22:28901750-28901772 GCTACTCAGGAGACTGAAGCAGG - Intronic
1182260806 22:29072254-29072276 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1182425371 22:30268737-30268759 GCTACTCAGGAGACTAAGGCGGG - Intergenic
1182597749 22:31435244-31435266 GCAACTGGTGTGATCAAAGCAGG + Intronic
1182632553 22:31698134-31698156 GCTACTCATGAGGCTAAGGCAGG - Intronic
1182720113 22:32390960-32390982 GCAACTCAGGAGACTGAAGCTGG - Intronic
1182853833 22:33499883-33499905 GCTACTCAGGAGATTGAGGCAGG - Intronic
1183260600 22:36792917-36792939 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1183656221 22:39186323-39186345 GCAACTCAGGAGGCTAAGGCAGG + Intergenic
1183753157 22:39733789-39733811 GCTACTCATGAGACTGAAGCAGG - Intergenic
1183824693 22:40376398-40376420 GCAACTCATGAGATTAAAGCAGG - Intronic
1183955527 22:41378455-41378477 GCAACTCGGGAGGTTGAAGCAGG - Intronic
1184216928 22:43073931-43073953 GGAACTCGGGAGATTGAAGCAGG - Intronic
1184350934 22:43943898-43943920 GCTACTCAGGAGACTGAAGCAGG - Intronic
1184393759 22:44220553-44220575 GCAACTCAGGAGGCTGAAGCAGG + Intergenic
1184552696 22:45212973-45212995 TCAACTCAGTAGATTAAACCGGG + Intronic
1184553700 22:45220341-45220363 GCTACTCAGGAGGTTAAAGCAGG + Intronic
1185025894 22:48411920-48411942 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1185201251 22:49506879-49506901 GCTACTCATGAGGCTAAGGCAGG + Intronic
949186653 3:1200143-1200165 CCTACTCATGAGACTGAAGCAGG - Intronic
949382024 3:3457253-3457275 GCTACTCATGAGGTTGAGGCAGG - Intergenic
949723130 3:7013677-7013699 GCAACTCAGGAGGCTGAAGCAGG + Intronic
949949804 3:9219737-9219759 GCTACTCATGAGGTTGAGGCAGG + Intronic
950908239 3:16558544-16558566 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
951460205 3:22943322-22943344 TGAACTCATGAGATCAGAGCAGG + Intergenic
951722942 3:25721292-25721314 GCAACTCAGGAGACTGAGGCAGG - Intronic
952179071 3:30898657-30898679 GCTACTCGGGAGATTGAAGCAGG + Intergenic
952311200 3:32191903-32191925 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
952345467 3:32480095-32480117 GCTACTCAGGAGGTTGAAGCAGG + Intronic
952625431 3:35397132-35397154 GCTACTCATGAGACTGAGGCAGG - Intergenic
952737597 3:36705879-36705901 GCTACTCAGGAGATTGAGGCAGG - Intergenic
952924254 3:38309635-38309657 GGAACCTAAGAGATTAAAGCTGG + Intronic
953054823 3:39379725-39379747 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
953317058 3:41938568-41938590 GCTACTCAGGAGACTAAGGCAGG + Intronic
953506803 3:43493845-43493867 GCTACTCAGGAGATTGAGGCAGG - Intronic
954027931 3:47797786-47797808 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
954186813 3:48923631-48923653 GCTACTCAGGAGGTTGAAGCAGG - Intronic
954207190 3:49068511-49068533 GCTACTCAGGAGACTGAAGCAGG + Intronic
954321743 3:49836712-49836734 GCCACTCAGGAGATTGAGGCAGG + Intronic
954504257 3:51053531-51053553 GCTACTCAGGAGGTTAAGGCAGG - Intronic
954524316 3:51256380-51256402 GCTACTCAGGAGACTAAGGCAGG - Intronic
954547803 3:51453839-51453861 GCTACTCAGGAGACTGAAGCAGG + Intronic
954562802 3:51572339-51572361 GCTACTCAGGAGACTAAGGCAGG + Intronic
954774737 3:53006515-53006537 GCTACTCAGGAGGCTAAAGCAGG + Intronic
954923029 3:54208215-54208237 GCTACTCAGGAGGTTAAGGCAGG - Intronic
954971868 3:54657915-54657937 GCTACTCAGGAGACTCAAGCGGG + Intronic
955013229 3:55040571-55040593 GCTACTCAGGAGGCTAAAGCGGG + Intronic
955331045 3:58047683-58047705 GCTACTCAGGAGACTAAGGCAGG - Intronic
955336679 3:58092532-58092554 GCTACTCAGGAGATTGAGGCAGG + Intronic
955804521 3:62720441-62720463 GCTACTCAGGAGACTAAAGTGGG - Intronic
955940736 3:64145209-64145231 GCTACTTAGGAGACTAAAGCAGG - Intronic
955970397 3:64433322-64433344 GAAACTCCTGAGATTAGATCTGG - Intronic
956233998 3:67046257-67046279 GCTACTCAAGAGGTTAAGGCAGG - Intergenic
956407486 3:68943308-68943330 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
956441194 3:69281710-69281732 GCTACTCAGGAGGCTAAAGCAGG + Intronic
956688837 3:71857561-71857583 GCAACTCAGGAGGCTAAGGCAGG - Intergenic
956796463 3:72722752-72722774 GCTACTCATGAGGTTAAGGTGGG + Intergenic
956994108 3:74804221-74804243 GCTACTCAGGAGACTAAGGCAGG - Intergenic
957826792 3:85457299-85457321 GCAACTCAGGAGCCTAAGGCAGG + Intronic
957935172 3:86933019-86933041 TAAACTCATGAAAATAAAGCAGG - Intergenic
960005059 3:112773226-112773248 GCTACTCAGGAGGCTAAAGCGGG + Intronic
960081092 3:113541279-113541301 GCTACTCATGAGGCTGAAGCAGG - Intronic
960861343 3:122157027-122157049 GCTACTCAGGAGATTGAGGCAGG - Intergenic
961058175 3:123806772-123806794 GCTACTCAGGAGGCTAAAGCAGG - Intronic
961265703 3:125640550-125640572 GCTACTCATGAGGATAAGGCAGG + Intergenic
962582659 3:136812370-136812392 GCTACTCAGGAGACTGAAGCAGG - Intergenic
963068789 3:141285256-141285278 GCCACTCAGGAGGCTAAAGCAGG - Intronic
963461752 3:145623035-145623057 GCTACTCAGGAGACTAAGGCAGG + Intergenic
963782208 3:149497754-149497776 GCTACTCAGGAGACTAAGGCTGG - Intronic
964285496 3:155113389-155113411 GCTACTCAGGAGGCTAAAGCAGG - Intronic
964342468 3:155722273-155722295 GCTACTCAGGAGGCTAAAGCAGG - Intronic
964400495 3:156292651-156292673 GCTACTCAGGAGGTTAAGGCAGG - Intronic
964415694 3:156445182-156445204 GCTACTCAGGAGGCTAAAGCAGG + Intronic
964576889 3:158180914-158180936 GCTACTCGGGAGACTAAAGCAGG - Intronic
964895292 3:161588605-161588627 GCTACTCAGGAGATGGAAGCAGG + Intergenic
964997279 3:162898329-162898351 GCTACTCATGAGGCTAAGGCAGG + Intergenic
965122335 3:164577251-164577273 GCTACTCGTGAGGTTGAAGCAGG - Intergenic
965162155 3:165147798-165147820 GCATATCATGGGAATAAAGCAGG + Intergenic
965264008 3:166517867-166517889 GCTACTCGTGAGACTGAAGCAGG + Intergenic
965582835 3:170287796-170287818 GCTACTCAGGAGACTAAGGCAGG + Intronic
965709298 3:171540973-171540995 GCTACTCAGGAGACTAAGGCAGG - Intergenic
965842724 3:172925935-172925957 GCTACTCAGGAGGCTAAAGCAGG - Intronic
965985698 3:174750543-174750565 GCTACTCAGGAGGTTGAAGCAGG - Intronic
966206312 3:177410060-177410082 GCTACTCAGGAGATTGAGGCAGG + Intergenic
966725668 3:183105975-183105997 GCTACTCAGGAGGTTGAAGCAGG + Intronic
966754573 3:183356399-183356421 GCTACTCAGGAGGTTGAAGCAGG + Intronic
967125609 3:186421366-186421388 GCTACTCAGGAGACTAAGGCAGG - Intergenic
967167894 3:186800065-186800087 GCTACTCAGGAGGCTAAAGCGGG - Intronic
967242094 3:187449588-187449610 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
967672087 3:192248664-192248686 GCTACTCATGAGACTGAGGCGGG + Intronic
968417886 4:456180-456202 GCTACTCAGGAGACTAAGGCAGG - Intronic
968796002 4:2705021-2705043 GCTACTCAGGAGGTTGAAGCAGG - Intronic
969004743 4:4010207-4010229 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
969004916 4:4011406-4011428 GCTACTCATGAGGCTGAAGCAGG - Intergenic
969424325 4:7115343-7115365 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
969804069 4:9592731-9592753 GCTACTCAGGAGACTGAAGCAGG + Intergenic
969949469 4:10819559-10819581 GCTACTCAGGAGACTGAAGCAGG + Intergenic
970119081 4:12732427-12732449 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
970713883 4:18897435-18897457 GCTACTCAGGAGACTAAGGCAGG + Intergenic
970898515 4:21131496-21131518 GCTACTCAGGAGATTGAGGCAGG + Intronic
972118438 4:35668762-35668784 GCAACTCAGGAGGCTAAGGCAGG - Intergenic
972410803 4:38792525-38792547 GCAACTCAGGAGACTGAGGCAGG - Intronic
972516773 4:39816524-39816546 CCAACTCAGGAGACTAAAGCTGG - Intergenic
972820299 4:42694258-42694280 GCTACTCAGGAGACTGAAGCAGG - Intergenic
973307863 4:48673497-48673519 GCTACTTATGAGATTGAGGCTGG - Intronic
973673383 4:53239594-53239616 GCTACTCATGAGGCTAAGGCAGG - Intronic
973747448 4:53977851-53977873 GCTACTCAGGAGACTGAAGCAGG - Intronic
973799450 4:54461817-54461839 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
973803779 4:54504201-54504223 GCTACTCAGGAGTCTAAAGCAGG - Intergenic
974052613 4:56955100-56955122 CCTACTCATGAGATTAGAACCGG - Intergenic
974436076 4:61858507-61858529 GCTACTCAGGAGGCTAAAGCAGG + Intronic
974448163 4:62013774-62013796 GCAACTCAGGAGGCTGAAGCAGG + Intronic
974981245 4:68960011-68960033 GCTACTCATGAGGTTGAGGCAGG + Intergenic
975008449 4:69320200-69320222 GCTACTCAGGAGATTGAGGCAGG + Intronic
975354140 4:73380755-73380777 GCTACTCAAGAGTTTAAGGCAGG - Intergenic
975640853 4:76498849-76498871 GTAACCCATGAAATTAAAGAAGG + Intronic
975829884 4:78357789-78357811 GCTACTCAAGAGAATGAAGCAGG + Intronic
976361404 4:84182750-84182772 GCTACTCAGGAGACTGAAGCAGG + Intergenic
976724542 4:88202745-88202767 GCTACTCAGGAGGCTAAAGCAGG + Intronic
976864992 4:89714536-89714558 GCTACTCAGGAGATTGAGGCAGG - Intergenic
976999016 4:91471856-91471878 GCTACTCATGAGACTGAGGCAGG + Intronic
977143993 4:93412283-93412305 GCTACTCAAGAGTTTGAAGCAGG + Intronic
977384616 4:96323759-96323781 GCAACTCAGGAGGTTGAGGCAGG + Intergenic
977816917 4:101425506-101425528 GCTACTCAAGAGATTAAGGCAGG - Intronic
978333189 4:107637870-107637892 GGAACTCATGAGATTAATTAAGG - Intronic
978941468 4:114440829-114440851 GCTACTCAGGAGATTGAGGCAGG + Intergenic
979140640 4:117169546-117169568 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
979800310 4:124899891-124899913 GCCACTCTTGAGACTCAAGCAGG - Intergenic
979869291 4:125797503-125797525 GCTACTCAGGAGACTGAAGCCGG - Intergenic
980099324 4:128525318-128525340 GCTACTCAGGAGATTGAGGCAGG + Intergenic
980369790 4:131852504-131852526 GCTACTCAGGAGACTGAAGCAGG + Intergenic
980894698 4:138850991-138851013 GCTACTCAGGAGACTAAGGCAGG - Intergenic
981032467 4:140139159-140139181 GCTACTCAGGAGACTGAAGCAGG + Intronic
981084988 4:140674567-140674589 GCTACTCATGGGACTAAGGCAGG + Intronic
981198399 4:141947407-141947429 GCAACTCAGGAGACTGAGGCAGG - Intergenic
981711474 4:147713038-147713060 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
981842999 4:149134218-149134240 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
982248458 4:153379736-153379758 GCTACTCAGGAGACTGAAGCAGG + Intronic
982307103 4:153944171-153944193 GCATATCATGTGATGAAAGCAGG + Intergenic
982381306 4:154751620-154751642 GCTACTCATGAGGTTGAGGCAGG + Exonic
982457742 4:155630505-155630527 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
982736127 4:159008455-159008477 GCAACTCAGGAGGCTAAGGCAGG + Intronic
982795279 4:159636897-159636919 GCTACTCATGAGGTTGAGGCAGG - Intergenic
982995407 4:162337974-162337996 GCTACTCATGAGGCTAAGGCAGG - Intergenic
983465489 4:168083195-168083217 GCTACTCAGGAGACTAAGGCAGG - Intergenic
983476647 4:168219922-168219944 GCTACTCAGGAGATTGAGGCAGG + Intronic
983554398 4:169046847-169046869 GCCACACATGGGATTTAAGCAGG + Intergenic
983725890 4:170925548-170925570 GCAACTCAGGAGGCTAAAGCAGG - Intergenic
983906376 4:173186874-173186896 GCTACTCGTGAGAGTAAGGCAGG - Intronic
984409738 4:179381406-179381428 GCTACTCAGGAGATTGAAGTGGG - Intergenic
984451473 4:179908741-179908763 GCTACTCAGGAGACTGAAGCAGG + Intergenic
984478951 4:180274463-180274485 GCTACTCAGGAGATTGAAGCGGG + Intergenic
984633073 4:182080877-182080899 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
984640784 4:182162128-182162150 GCAACTCAAGAGACTGAGGCAGG - Intronic
985514943 5:337488-337510 GCTACTCAGGAGACTAAGGCAGG - Intronic
987125969 5:14813127-14813149 GCTACTCAGGAGGCTAAAGCAGG + Intronic
987316046 5:16725196-16725218 GCTACTCAGGAGACTAAGGCAGG - Intronic
987358050 5:17082333-17082355 GCTACTCAGGAGAGTGAAGCAGG + Intronic
987397866 5:17442894-17442916 GCACCTCATGTGACTGAAGCAGG + Intergenic
987603629 5:20105097-20105119 GCTACTCAAGAGGTTAAAGCAGG - Intronic
987614265 5:20252237-20252259 GCTACTCATGAGACTGACGCAGG + Intronic
987651390 5:20744749-20744771 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
987710952 5:21500025-21500047 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
988559013 5:32263547-32263569 GCTACTCATGAGGCTAAGGCGGG - Intronic
988744166 5:34116704-34116726 GCTACTCAGGAGGCTAAAGCAGG - Intronic
988749189 5:34177596-34177618 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
988965814 5:36416631-36416653 GCAGCTGATTAGATTAAGGCTGG + Intergenic
988985993 5:36619391-36619413 GCAACTCAGGGGGTTAAGGCAGG + Intronic
989054358 5:37352424-37352446 GCAACTCAAGAGACTGAAGCAGG + Intronic
989336291 5:40320647-40320669 TCAACTCATGGGATGGAAGCAGG - Intergenic
989720437 5:44522091-44522113 GCAACTCATGAGGCTGAGGCAGG - Intergenic
989791333 5:45405517-45405539 GCTACTCAGGAGGTTGAAGCAGG - Intronic
989975053 5:50575260-50575282 GCGACTCAAGAGACTGAAGCAGG - Intergenic
990127195 5:52533133-52533155 GCAACTCAGGAGACTGAGGCAGG + Intergenic
990571793 5:57086264-57086286 GCTACTCAGGAGATTGAGGCAGG - Intergenic
990967886 5:61469627-61469649 ATAACTCATGTGAATAAAGCAGG + Intronic
991494202 5:67211653-67211675 GCTACTCATGAGGCTAAGGCAGG - Intergenic
991647213 5:68812501-68812523 GCTACTCAGGAGATTGAGGCAGG + Intergenic
991689437 5:69212373-69212395 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
991704715 5:69347037-69347059 GCTACTCAGGAGACTGAAGCGGG - Intergenic
991761291 5:69919085-69919107 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
991786038 5:70199015-70199037 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
991840519 5:70794136-70794158 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
991878482 5:71199403-71199425 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
992022606 5:72639080-72639102 GAAACTCATGACTTTAAAGCAGG - Intergenic
992408420 5:76481492-76481514 GCTACTCAGGAGACTAAAGCCGG - Intronic
992539883 5:77753868-77753890 GCTACTCATGAGGCTGAAGCAGG - Intronic
992586813 5:78249253-78249275 GCTACTCAGGAGACTGAAGCAGG + Intronic
993065658 5:83094795-83094817 GCAACTCAGGAGGCTGAAGCAGG - Intronic
994238196 5:97390427-97390449 GCTACTCAGGAGACTAAGGCAGG - Intergenic
994501883 5:100589374-100589396 GCACCTCATCAGATTCTAGCTGG + Intergenic
994756037 5:103794405-103794427 GCAACTCAGGAGGATAAGGCAGG - Intergenic
994993620 5:107031052-107031074 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
995807358 5:116068491-116068513 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
996204616 5:120716758-120716780 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
996715786 5:126586965-126586987 GCTACTCAGGAGATTGAGGCAGG + Intronic
996771011 5:127085595-127085617 ACAAGTCATGAGAGGAAAGCTGG + Intergenic
997244728 5:132337845-132337867 GCAACTCAGGAGGTTGAGGCAGG - Intronic
997547502 5:134721449-134721471 GCTACTCAGGAGATTGAGGCAGG + Intronic
997713728 5:136027451-136027473 GCATCCCATGAGGATAAAGCTGG - Intergenic
997864384 5:137448134-137448156 GCTACTCAGGAGGCTAAAGCAGG + Intronic
997867281 5:137475692-137475714 GCTACTCATGAGGTTGAGGCAGG - Intronic
997896393 5:137721692-137721714 GCTACTCAGGAGGTTGAAGCAGG + Intronic
997901961 5:137774880-137774902 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
998005668 5:138655262-138655284 GCTACTCAGGAGACTGAAGCAGG + Intronic
998014074 5:138718437-138718459 GCTACTCAGGAGGTTGAAGCAGG - Intronic
998062458 5:139129558-139129580 GCTACTCAGGAGACTGAAGCCGG + Intronic
998154074 5:139774600-139774622 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
998434034 5:142091772-142091794 GCTACTCAGGACACTAAAGCTGG + Intergenic
998844846 5:146298094-146298116 GCAACTCAGGAGACTGAGGCAGG + Intronic
999288035 5:150405884-150405906 GCTACTCATGAGGTTGAGGCAGG - Intronic
999995775 5:157090953-157090975 GCTACTCAGGAGAATGAAGCAGG - Intronic
1000077184 5:157802004-157802026 GCTACTCAGGAGACTAAGGCAGG - Intronic
1000080419 5:157840081-157840103 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1000214069 5:159138246-159138268 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1000305287 5:159988866-159988888 GCTACTCAGGAGACTAAAACAGG + Intergenic
1000864606 5:166497649-166497671 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1001020796 5:168180788-168180810 GCTACTCAGGAGACTAAGGCAGG + Intronic
1001295584 5:170496609-170496631 TCACCTCAGGAGACTAAAGCAGG + Intronic
1001499407 5:172217595-172217617 GCTACTCATGAGACTAAGGCAGG - Intronic
1001802612 5:174557293-174557315 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1002017579 5:176337480-176337502 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1002035453 5:176465477-176465499 GCTACTCAAGAGGTTGAAGCAGG - Intronic
1002129921 5:177074534-177074556 GCTACTCAGGAGACTAAGGCAGG + Intronic
1002472620 5:179445595-179445617 GCTACTCTGGAGATTGAAGCAGG + Intergenic
1003287511 6:4747193-4747215 GCTACTCATGAGATTGAGGCAGG + Intronic
1003810752 6:9777233-9777255 GCAACTCAGGAGATTGAGGCAGG - Intronic
1003919932 6:10823639-10823661 GCAACTCAGGAGGCTGAAGCAGG - Intronic
1004066374 6:12248716-12248738 GCAAACCATGTGATTAAGGCTGG + Intergenic
1004392119 6:15218622-15218644 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1004411081 6:15382149-15382171 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1004472504 6:15941724-15941746 GCTACTCAGGAGGTCAAAGCAGG + Intergenic
1004495305 6:16157243-16157265 GCAAGTAGTGAGATTTAAGCTGG - Intergenic
1004693556 6:18012883-18012905 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1004777987 6:18870327-18870349 GCTACTCATGAGGCTGAAGCAGG + Intergenic
1004897795 6:20165629-20165651 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1005406228 6:25490584-25490606 GCCACTCAGGAGGTTGAAGCGGG + Intronic
1005546739 6:26880472-26880494 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1005592476 6:27343294-27343316 GCTACTCATGAGACTGAATCAGG - Intergenic
1005921052 6:30402084-30402106 GCTACTCAAGAGACTAAGGCAGG + Intergenic
1006111378 6:31747890-31747912 GCTACTCAGGAGACTAAGGCAGG + Intronic
1006128783 6:31856013-31856035 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1006356796 6:33563913-33563935 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1006488566 6:34365927-34365949 GCTACTCAGGAGACTGAAGCAGG + Intronic
1006813201 6:36834145-36834167 GCAACTCAGGAGGCTAAGGCAGG + Intronic
1006863936 6:37193224-37193246 GCTACTCAGGAGAGTAAGGCAGG - Intergenic
1007086743 6:39153349-39153371 GCTACTCAGGGGACTAAAGCAGG - Intergenic
1007645207 6:43374522-43374544 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1008126838 6:47678548-47678570 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1008220663 6:48850738-48850760 GCAACTCAGGAGGTTGAGGCAGG - Intergenic
1008375169 6:50783079-50783101 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1009017492 6:57921555-57921577 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1009338216 6:62520764-62520786 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1009968222 6:70599836-70599858 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1010692866 6:78931298-78931320 GCTACTCATGAGGCTAAGGCAGG + Intronic
1011438340 6:87362046-87362068 CCCACTCATGAGCTTGAAGCAGG + Intronic
1011467819 6:87676666-87676688 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1012930105 6:105307722-105307744 GCTACTCAGGAGACTGAAGCAGG - Intronic
1013140876 6:107333645-107333667 GTTACTCAGGAGACTAAAGCAGG - Intronic
1013247388 6:108299689-108299711 GCTACTCATGAGGCCAAAGCAGG + Intronic
1013276799 6:108593487-108593509 GCTACTCATGAGGCTGAAGCAGG - Intronic
1013532690 6:111034529-111034551 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1014097775 6:117479222-117479244 GCTACTCAAGAGATTGAGGCAGG - Intronic
1014623869 6:123702130-123702152 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1014697484 6:124641661-124641683 GCTACTCATGAGGCTGAAGCAGG - Intronic
1015336117 6:132040926-132040948 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1015863428 6:137704150-137704172 GCTACTCAGGAGATTGAAGCAGG - Intergenic
1016510913 6:144841996-144842018 GCAACTCAGGAGGTTGAGGCAGG + Intronic
1016637736 6:146314176-146314198 GCTACTCGTGAGATTGAGGCAGG - Intronic
1016937802 6:149460716-149460738 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1017109481 6:150919049-150919071 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1017181747 6:151560194-151560216 GTAAACAATGAGATTAAAGCAGG - Intronic
1017186166 6:151602910-151602932 GCAACTCAAGAGGCTGAAGCAGG - Intronic
1017200825 6:151753427-151753449 GCTACTCAGGAGATTGAGGCAGG - Intronic
1017426880 6:154331153-154331175 GCTACTCAGGAGACTGAAGCAGG + Intronic
1017799325 6:157878542-157878564 GCTACTCAGGAGATTGACGCAGG - Intronic
1019380678 7:721255-721277 GAAACTCATGAGGTGAAAGATGG + Intronic
1019930304 7:4218279-4218301 GCTACTCATGAGGCTAAGGCAGG + Intronic
1019953967 7:4398257-4398279 GAAACTCTTGAGATTGAAGAGGG - Intergenic
1020041838 7:5009459-5009481 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1020445771 7:8265830-8265852 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1020796573 7:12684863-12684885 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1020801024 7:12732679-12732701 GCTACTCAAGAGGTTGAAGCCGG - Intergenic
1022303933 7:29128602-29128624 GCTACTCATGAGGTTGAGGCAGG + Intronic
1022395555 7:29985291-29985313 GCTACTCAGGAGACTAAAGCAGG + Intronic
1022817173 7:33924777-33924799 GCTACTCAGGAGATTGAGGCAGG - Intronic
1023384378 7:39641058-39641080 GCAAGGCATGAGACTCAAGCTGG - Intronic
1023500799 7:40847526-40847548 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1023928273 7:44687207-44687229 GCTACTCAGGAGACTGAAGCAGG - Intronic
1024177354 7:46854556-46854578 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1024740927 7:52353624-52353646 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1025077959 7:55959097-55959119 GCTACTCAGGAGACTAAGGCAGG + Intronic
1025095924 7:56095313-56095335 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1025984521 7:66436729-66436751 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1026021957 7:66715237-66715259 GCTACTCGGGAGACTAAAGCAGG - Intronic
1026030238 7:66786513-66786535 GCTACTCAGGAGACTAAGGCAGG - Intronic
1026041679 7:66873374-66873396 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1026265244 7:68790778-68790800 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
1026324102 7:69294043-69294065 GCTACTCAAGAGACTGAAGCAGG + Intergenic
1026341366 7:69436826-69436848 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1026518896 7:71097912-71097934 GCAAGTCATGGGATTAAAATTGG + Intergenic
1026623735 7:71974304-71974326 GCTACTCAGGAGATTGAGGCAGG + Intronic
1026743837 7:72996129-72996151 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1026803763 7:73416815-73416837 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1027029948 7:74880822-74880844 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1027207671 7:76115018-76115040 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1027407481 7:77877225-77877247 GCAACTCAGGAGGCTGAAGCAGG - Intronic
1027514371 7:79123672-79123694 GCAACTCAGGAGACTGAGGCAGG + Intronic
1027763531 7:82309292-82309314 GCAACTCAGGAGGTTGAGGCAGG + Intronic
1028054714 7:86227071-86227093 ACAAATCATGAGATATAAGCTGG - Intergenic
1028206483 7:88023529-88023551 GCTACTCAGGAGATTGAGGCAGG - Intronic
1029250716 7:99234117-99234139 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1029539650 7:101175064-101175086 GCAACTCAGGAGGTGAAGGCAGG - Intronic
1029623218 7:101702989-101703011 GCTACTCAGGAGGCTAAAGCCGG - Intergenic
1029724715 7:102395050-102395072 GCTACTCAGGAGACTGAAGCAGG + Intronic
1029731076 7:102438659-102438681 GCTACTCAGGAGACTGAAGCAGG + Intronic
1029906137 7:104095085-104095107 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1029972076 7:104799672-104799694 GCAACTTAGGAGATGGAAGCAGG + Intronic
1030017107 7:105233746-105233768 GCTACTCAGGAGACTGAAGCAGG + Intronic
1030283653 7:107802611-107802633 GCTACTCAAGAGGCTAAAGCAGG - Intronic
1030283763 7:107803945-107803967 GCTACTCAGGAGGTTAAAGCAGG - Intergenic
1030911243 7:115251866-115251888 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1031523095 7:122790285-122790307 GCTACTCAAGAGGCTAAAGCAGG + Intronic
1031944486 7:127825220-127825242 GCTACTCAGGAGACTAAGGCAGG - Intronic
1032059235 7:128710027-128710049 GCTACTCAGGAGATTGAGGCAGG - Intronic
1032226313 7:130034604-130034626 GCTACTCGTGAGGTTGAAGCAGG - Intronic
1032337452 7:131038825-131038847 GGAACTCAGAAGATTAAGGCTGG - Intergenic
1032348412 7:131138035-131138057 GCTACTCATGAGATTGAGGCAGG - Intronic
1032636551 7:133715257-133715279 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1032859606 7:135864732-135864754 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1032888418 7:136166975-136166997 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1033211151 7:139461135-139461157 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034074530 7:148219052-148219074 GCTACTCAGGAGGTTAAGGCAGG - Intronic
1034173794 7:149084248-149084270 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1034286819 7:149889744-149889766 GCTACTCAGGAGGTTGAAGCGGG + Intergenic
1034403036 7:150878433-150878455 GCAACTCATGAGGCTGAGGCAGG + Intergenic
1034616042 7:152417751-152417773 GCTACTCAGGAGGTTGAAGCAGG - Intronic
1034629261 7:152517728-152517750 GCCACTCAGGAGGCTAAAGCAGG + Intergenic
1035136698 7:156710014-156710036 GCTACTCAGGAGATTGAGGCAGG - Intronic
1035207762 7:157305478-157305500 GCTACTCAGGAGACTAAGGCCGG + Intergenic
1035413669 7:158666678-158666700 GCAACTCAGGAGACCAAGGCAGG + Intronic
1036149050 8:6281197-6281219 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1036393433 8:8345681-8345703 GCTACTCAGGAGACTAAGGCAGG + Intronic
1037072948 8:14675048-14675070 GCAACTCCTGAGGCTGAAGCAGG - Intronic
1037170443 8:15885706-15885728 GCAACTCAGGAGGCTAAGGCAGG + Intergenic
1037317129 8:17609524-17609546 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1037372353 8:18193751-18193773 GCTACTCAGGAGACTAAGGCAGG - Intronic
1037425803 8:18753240-18753262 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1037854172 8:22358308-22358330 GCTACTCAGGAGACTAAAGCAGG + Intergenic
1038317828 8:26502569-26502591 GCTACTCAGGAGACTGAAGCAGG - Intronic
1038603397 8:28972322-28972344 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1038627688 8:29209942-29209964 GCTACTCAGGAGACTGAAGCAGG + Intronic
1038671520 8:29586815-29586837 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1039054204 8:33521743-33521765 GCAACTCAGGAGACTGAGGCAGG + Intergenic
1039405070 8:37305590-37305612 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
1039543435 8:38389885-38389907 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1039737000 8:40343637-40343659 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1040504889 8:48038425-48038447 GCTACTCAGGAGACTAAGGCGGG - Intronic
1040733507 8:50478207-50478229 GAAAACCATGAGATTAAAGGTGG + Intronic
1041055586 8:53982494-53982516 GCTACTCAGGAGACTAAGGCAGG + Intronic
1041092333 8:54314796-54314818 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1041152070 8:54945039-54945061 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1041302178 8:56423507-56423529 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1041506221 8:58600509-58600531 GCTACTCAGGAGACTGAAGCAGG + Intronic
1041614722 8:59893056-59893078 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1041763405 8:61392218-61392240 GCTACTCAGGAGACTGAAGCAGG + Intronic
1042033774 8:64507531-64507553 GCAACTCAGGAGGCTGAAGCAGG + Intergenic
1042256390 8:66808623-66808645 GCTACTCATGAGGTTGAGGCAGG - Intronic
1042269824 8:66943475-66943497 GCTACTCAGGAGATTAAAGTAGG - Intergenic
1042497676 8:69472946-69472968 GCTACTCATGAGACTGAGGCAGG - Intronic
1042596977 8:70460174-70460196 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1042705228 8:71659773-71659795 GCTACTCAAGAGGTTGAAGCAGG + Intergenic
1043221528 8:77671623-77671645 GCAATACTTAAGATTAAAGCAGG + Intergenic
1043354800 8:79400089-79400111 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1043951660 8:86316312-86316334 GCTACTCAGGAGACTAAGGCAGG - Intronic
1044114593 8:88319478-88319500 GCAACTGTTGAGAGTAAAGAAGG + Intronic
1044247858 8:89970135-89970157 GCTACTCAGGAGACTAAGGCAGG + Intronic
1044523128 8:93222829-93222851 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
1044891967 8:96845929-96845951 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1045100642 8:98840458-98840480 GCTACTCAGGAGACTAAGGCAGG + Intronic
1045124549 8:99074745-99074767 GCTACTCAGGAGATTGAGGCAGG - Intronic
1045291567 8:100837381-100837403 GCTACTCAGGAGACTAAAGCAGG + Intergenic
1045445262 8:102255997-102256019 GAAACTCATGAGATTTAAGTTGG + Intronic
1045468250 8:102488839-102488861 GCTACTCAGGAGGTTGAAGCGGG - Intergenic
1045568638 8:103347105-103347127 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1045723981 8:105149382-105149404 GCAACACATGTCATTAAAGTTGG - Intronic
1046287088 8:112108293-112108315 GCAACTCAGGAGGCTGAAGCAGG - Intergenic
1046577368 8:116047551-116047573 CAAATTCATGAAATTAAAGCTGG - Intergenic
1046649982 8:116827032-116827054 GCTACTCAGGAGGTTAAGGCAGG + Intronic
1046795734 8:118369601-118369623 GCTACTCAGGAGGTTGAAGCAGG + Intronic
1047284545 8:123476058-123476080 GCAACTCAGGAGACTGAAGTGGG - Intergenic
1047389497 8:124438595-124438617 GCAACTCAGGAGACTAAGGCAGG + Intergenic
1048064183 8:130950809-130950831 GCTACTCAGGAGACTAAGGCAGG - Intronic
1048501605 8:134980945-134980967 GCTACTCAAGAGACTGAAGCAGG + Intergenic
1049049548 8:140183741-140183763 GCTACTCAGGAGACTGAAGCAGG + Intronic
1049164648 8:141118477-141118499 GCTACTCATGAGACTGAGGCAGG - Intronic
1049588765 8:143445267-143445289 GCTACTCAGGAGATTGAGGCAGG + Intronic
1049739999 8:144234626-144234648 GCTACTCAGGAGACTAAGGCAGG - Intronic
1049965415 9:775010-775032 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1050427499 9:5526547-5526569 GCTACTCAGGAGATTGAGGCAGG - Intronic
1050498853 9:6272926-6272948 GCAACTCAGGAGGTTGAGGCAGG - Intergenic
1052148948 9:25088485-25088507 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1052249002 9:26375091-26375113 GCAACTCAGGAGGTTGAGGCAGG + Intergenic
1052944472 9:34156888-34156910 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1052961273 9:34299290-34299312 GCTACTCAGGAGACTGAAGCAGG - Intronic
1053091540 9:35282541-35282563 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1053127665 9:35596151-35596173 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
1053323145 9:37118569-37118591 GCCACTCCTGAGGTTAAGGCAGG - Intergenic
1053344348 9:37367059-37367081 GCCACTCAGGAGGCTAAAGCAGG + Intergenic
1053489896 9:38490688-38490710 GCAACTCAGGAGACTGAGGCGGG + Intergenic
1053491735 9:38511265-38511287 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
1054924902 9:70579407-70579429 GCTACTCGTGAGGTTAAGGCAGG - Intronic
1054979247 9:71184808-71184830 GCAACACATGAAATTAAATTTGG - Intronic
1055297800 9:74852301-74852323 GCTACTCAGGAGATTGAGGCTGG - Intronic
1055655406 9:78445983-78446005 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1056172708 9:84003153-84003175 GCAACTCAAGAGGCTAAGGCAGG - Exonic
1056214516 9:84394671-84394693 GCTACTCATGAGACTGAGGCAGG - Intergenic
1056632558 9:88305819-88305841 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1056651270 9:88466268-88466290 GCAACTCAGGAGACTGAGGCAGG - Intronic
1056843764 9:90019570-90019592 GCAACTCATGGGATTGAATTGGG + Intergenic
1056884860 9:90431601-90431623 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1057002952 9:91529809-91529831 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1057366265 9:94424344-94424366 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1057375860 9:94521930-94521952 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1057657067 9:96963720-96963742 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1057670222 9:97079989-97080011 GCAACTCAGGAGACTGAGGCGGG + Intergenic
1057672032 9:97100468-97100490 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
1057741162 9:97712386-97712408 GCTACTCATGAGGTTAAGGTGGG + Intergenic
1058059669 9:100481891-100481913 GCAACTCAGGAGGCTAAGGCAGG - Intronic
1058222649 9:102321428-102321450 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1058362048 9:104159706-104159728 GCTACTCATGAGGCTGAAGCAGG - Intergenic
1058378887 9:104357158-104357180 GCTACTCATGAGGTTGAGGCAGG + Intergenic
1058433269 9:104938189-104938211 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1058498148 9:105582300-105582322 ACAACTCAGGAGATTGAGGCAGG - Intronic
1058651978 9:107183679-107183701 GCTACTCATGAGACTGAAGTGGG + Intergenic
1058711041 9:107679428-107679450 GCTACTCAGGAGGGTAAAGCAGG - Intergenic
1058842459 9:108923258-108923280 GCTACTCAAGAGACTAAAGTAGG + Intronic
1058856934 9:109071490-109071512 GCTACTCAGGAGACTAAAGTGGG + Intronic
1059087207 9:111317222-111317244 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1059135403 9:111801855-111801877 GCTACTCAGGAGGTTGAAGCAGG + Intergenic
1059156726 9:111995986-111996008 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1059174958 9:112161266-112161288 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1059200940 9:112415995-112416017 GCTACTCAGGAGACTGAAGCAGG + Intronic
1059203697 9:112443616-112443638 GCTACTCAGGAGACTGAAGCAGG + Intronic
1059215123 9:112554384-112554406 GCTACTCATGAGACTGAGGCAGG + Intronic
1060483026 9:124028996-124029018 GCCACTCAGGAGATTGAGGCAGG + Intronic
1060506774 9:124203720-124203742 GCTACTCATGAGGCTAAGGCAGG - Intergenic
1060565768 9:124589951-124589973 GCTACTCAGGAGATTGAGGCAGG + Intronic
1060634960 9:125192707-125192729 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1060646423 9:125284294-125284316 GCTACTCAGGAGGTTAAGGCAGG - Intronic
1061021122 9:128015542-128015564 GCTACTCAGGAGGTTAAGGCAGG - Intergenic
1061070559 9:128307617-128307639 GCAACTCTGGAGACTAAGGCAGG + Intergenic
1061089303 9:128417988-128418010 GCTACTCAGGAGACTGAAGCAGG + Intronic
1061118986 9:128631713-128631735 GCTACTCAGGAGATTGAGGCAGG + Intronic
1061131296 9:128709638-128709660 GCTACTCAGGAGGCTAAAGCAGG + Intronic
1061141993 9:128772655-128772677 GCTACTCAGGAGACTGAAGCAGG + Intergenic
1061211566 9:129196587-129196609 GCTACTCAGGAGGTTGAAGCAGG - Intergenic
1061497761 9:130985388-130985410 GCTACTCAAGAGACTGAAGCGGG - Intergenic
1061553818 9:131353764-131353786 GCCACTCAGGAGGTTAAAGCAGG + Intergenic
1061553864 9:131354067-131354089 GCCACTCAGGAGACTGAAGCAGG + Intergenic
1061867869 9:133504188-133504210 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1062420692 9:136480534-136480556 GAATCTCATAAGATTAAACCCGG - Intronic
1062450391 9:136613207-136613229 GCAACTCAGGAGACTGAGGCAGG + Intergenic
1185513743 X:682773-682795 GCAACTTCTGAGATGCAAGCAGG + Intergenic
1185522950 X:755304-755326 GCTACTCAGGAGGTTAAGGCAGG + Intergenic
1185703502 X:2249302-2249324 GCTACTCAGGAGGTTAAGGCAGG - Intronic
1185757487 X:2663234-2663256 GCTACTCAGGAGATTGAGGCAGG + Intergenic
1186529179 X:10278091-10278113 GCTACTCATGAGACTGAAGTGGG + Intergenic
1186862444 X:13686841-13686863 GCAACTCAGGAGACTGAGGCAGG - Intergenic
1187046420 X:15651583-15651605 GCAACTGATCAAATTAAAACAGG - Intronic
1187333574 X:18362511-18362533 GCAACTCAGGAGGCTAAGGCAGG + Intergenic
1187780124 X:22811866-22811888 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1187856811 X:23644720-23644742 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1187906591 X:24072393-24072415 GCAACTCAGGAGGTTAAGGTGGG - Intronic
1188246897 X:27847081-27847103 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1188269541 X:28121659-28121681 GCTACTTAGGAGATTGAAGCAGG - Intergenic
1188381838 X:29504070-29504092 GCAACTCAGGAGACTGAGGCAGG - Intronic
1188911507 X:35853501-35853523 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1189238304 X:39505897-39505919 GCTACTCATGAGACTGAGGCAGG + Intergenic
1189419159 X:40841013-40841035 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1189589618 X:42497188-42497210 GGAACTTCTGAGAGTAAAGCAGG - Intergenic
1189774434 X:44457521-44457543 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1189793899 X:44629170-44629192 GCTACTCAGGAGTCTAAAGCAGG - Intergenic
1189817869 X:44842246-44842268 GCTACTCATGAGACTGAGGCAGG + Intergenic
1189832879 X:44992660-44992682 GCTACTCAGGAGGTTGAAGCAGG - Intronic
1190009764 X:46774516-46774538 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1190042071 X:47079540-47079562 GCGACTCATGAGGCTGAAGCAGG - Intronic
1190220190 X:48508103-48508125 GCTACTCGGGAGGTTAAAGCAGG - Intergenic
1190229670 X:48572489-48572511 GCTACTCAGGAGACTAAAGCAGG + Intergenic
1190381092 X:49840428-49840450 GCTACTCAGGAGAGTAAGGCAGG - Intergenic
1192089073 X:68133465-68133487 GCATCTCTTGAGGTTAAACCTGG - Intronic
1193298276 X:79857687-79857709 GCTACTCAGGAGACTAAGGCAGG + Intergenic
1193749878 X:85328314-85328336 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1194336149 X:92648780-92648802 GCTACTCAAGAGATTGAAGCAGG + Intergenic
1195151767 X:102078391-102078413 GCTACTCAGGAGATTGAAGTTGG + Intergenic
1195406358 X:104518387-104518409 GCTACTCAGGAGACTGAAGCAGG - Intergenic
1196436298 X:115677691-115677713 GCTACTCAAGAGACTGAAGCAGG + Intergenic
1196907443 X:120451574-120451596 GCTACTCAGGAGGCTAAAGCAGG - Intronic
1197108958 X:122749607-122749629 GCTACTCGGGAGATTGAAGCAGG - Intergenic
1197315215 X:124957470-124957492 GCTACTCAGGAGACTGAAGCAGG + Intronic
1197693945 X:129530795-129530817 GCTACTCAGGAGGCTAAAGCAGG + Intergenic
1197738463 X:129870805-129870827 GCTACTCAGGAGATTGAGGCAGG - Intergenic
1198053446 X:132970871-132970893 GGAACTCATGTGGTTAAATCAGG + Intergenic
1198380016 X:136075105-136075127 GCTACTCACGAGGTTGAAGCAGG - Intergenic
1199199145 X:145066864-145066886 GCTACTCATGAGGCTAAGGCAGG - Intergenic
1199389886 X:147267228-147267250 GCAACTCATGAGGCTGAAGTGGG + Intergenic
1200168056 X:154050863-154050885 GCCACTCTTGGGTTTAAAGCAGG + Intronic
1200278382 X:154755845-154755867 GCTACTCAGGAGATTGATGCTGG + Intergenic
1200407514 Y:2828463-2828485 GCTACTCAGGAGACTAAGGCAGG - Intergenic
1200644583 Y:5765527-5765549 GCTACTCAAGAGATTGAAGCAGG + Intergenic
1201721489 Y:17103268-17103290 GCTACTCAGGAGGCTAAAGCAGG - Intergenic
1202086528 Y:21142658-21142680 GCTACTCAAGAGGCTAAAGCAGG - Intergenic
1202198886 Y:22326391-22326413 GCTACTCAGGAGACTAAGGCAGG - Intronic
1202327934 Y:23712127-23712149 GCTACTGAGGAGATCAAAGCAGG + Intergenic
1202542836 Y:25957925-25957947 GCTACTGAGGAGATCAAAGCAGG - Intergenic