ID: 1183828224

View in Genome Browser
Species Human (GRCh38)
Location 22:40404864-40404886
Sequence CCCAAGCCCGGGTCCACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183828216_1183828224 12 Left 1183828216 22:40404829-40404851 CCATCAGTGCTGTGGAAGGGCTT 0: 1
1: 0
2: 0
3: 30
4: 172
Right 1183828224 22:40404864-40404886 CCCAAGCCCGGGTCCACTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 109
1183828212_1183828224 20 Left 1183828212 22:40404821-40404843 CCAAAAGGCCATCAGTGCTGTGG 0: 1
1: 0
2: 3
3: 31
4: 307
Right 1183828224 22:40404864-40404886 CCCAAGCCCGGGTCCACTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183828224 Original CRISPR CCCAAGCCCGGGTCCACTTC AGG Intronic