ID: 1183828344

View in Genome Browser
Species Human (GRCh38)
Location 22:40405343-40405365
Sequence AAGGAGTGGCCTCCCGCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 51}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183828337_1183828344 -6 Left 1183828337 22:40405326-40405348 CCCTCCAGGACCCTAACAAGGAG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1183828331_1183828344 4 Left 1183828331 22:40405316-40405338 CCCCAGGACCCCCTCCAGGACCC 0: 1
1: 0
2: 5
3: 50
4: 530
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1183828340_1183828344 -10 Left 1183828340 22:40405330-40405352 CCAGGACCCTAACAAGGAGTGGC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1183828328_1183828344 23 Left 1183828328 22:40405297-40405319 CCAGAAAGGGCAGTGGCAGCCCC 0: 1
1: 0
2: 2
3: 31
4: 278
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1183828338_1183828344 -7 Left 1183828338 22:40405327-40405349 CCTCCAGGACCCTAACAAGGAGT 0: 1
1: 0
2: 1
3: 5
4: 118
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1183828333_1183828344 2 Left 1183828333 22:40405318-40405340 CCAGGACCCCCTCCAGGACCCTA 0: 1
1: 0
2: 1
3: 40
4: 340
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1183828334_1183828344 -4 Left 1183828334 22:40405324-40405346 CCCCCTCCAGGACCCTAACAAGG 0: 1
1: 0
2: 0
3: 19
4: 165
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1183828332_1183828344 3 Left 1183828332 22:40405317-40405339 CCCAGGACCCCCTCCAGGACCCT 0: 1
1: 0
2: 2
3: 39
4: 391
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1183828326_1183828344 25 Left 1183828326 22:40405295-40405317 CCCCAGAAAGGGCAGTGGCAGCC 0: 1
1: 0
2: 3
3: 22
4: 269
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1183828327_1183828344 24 Left 1183828327 22:40405296-40405318 CCCAGAAAGGGCAGTGGCAGCCC 0: 1
1: 0
2: 2
3: 28
4: 268
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1183828336_1183828344 -5 Left 1183828336 22:40405325-40405347 CCCCTCCAGGACCCTAACAAGGA 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG 0: 1
1: 0
2: 1
3: 8
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183828344 Original CRISPR AAGGAGTGGCCTCCCGCTAC GGG Intronic
903541388 1:24098370-24098392 AAGGAGGAGGCTCCCGCTCCAGG - Intronic
907871811 1:58450369-58450391 GAGGAGTGGCTTCCCACTCCGGG + Intronic
924235107 1:241993786-241993808 AGGGATTGCCCTCCCCCTACTGG - Intergenic
1070801685 10:79247626-79247648 AAGGCCTGGCCTCACCCTACGGG - Intronic
1075666417 10:124233972-124233994 CAGGAGAGGCCCCCCGCTCCAGG + Intergenic
1077014940 11:395348-395370 CAGGACTGGCCTCCAGCCACTGG + Intronic
1084858100 11:72001564-72001586 AAGGAGAGGCCTCCAGGAACAGG + Intronic
1085136389 11:74092838-74092860 CAGGAGTGGCCACCCCCGACAGG - Intronic
1089101161 11:115963766-115963788 AAGTAGAGGCCTCCTGCTTCAGG + Intergenic
1091099389 11:132856411-132856433 CAGGAGAGGCCCCCCGCTCCAGG + Intronic
1091189884 11:133682430-133682452 AAGGAGGGGCTTCCTGTTACTGG + Intergenic
1093266919 12:17015227-17015249 GAGGAGTGGCCTCCAGGTTCAGG - Intergenic
1096897596 12:54839717-54839739 AAGGAGTGCCCTCCAGGTTCAGG - Intronic
1103735170 12:123056568-123056590 CAGGAGTGGCCTCCTGCTGCCGG + Intronic
1103822623 12:123711210-123711232 AAGCAGTGGCCCCCCGCCCCAGG - Intergenic
1111990976 13:95117005-95117027 ACGGAGCTGCCTCCCGCTGCTGG + Intronic
1113617294 13:111689764-111689786 AAAGAGGGGCCTCCCGCCCCAGG - Intergenic
1113622823 13:111775034-111775056 AAAGAGGGGCCTCCCGCCCCAGG - Intergenic
1116987173 14:51232733-51232755 GAGCAGAGGCCTTCCGCTACTGG + Intergenic
1142283340 16:89160682-89160704 AAGGAGAGGCCTCCCGAAGCCGG + Intergenic
1142351388 16:89582424-89582446 AAGGAGTGGCCTCCCCTTTCTGG - Intronic
1142589589 17:996716-996738 GAGGAGTGGCCGCGCGCTCCGGG - Intergenic
1147252955 17:39164761-39164783 AAGGAGGGACCTGCCGCTAGAGG + Intronic
1148680829 17:49472631-49472653 AAGGCGTGGCCACCCCCTCCTGG - Intronic
1152209406 17:78995140-78995162 AAGGAGTGGACGACCACTACGGG - Exonic
1157575548 18:48740749-48740771 AAGGAGTGGACTCCAGCTCCTGG + Intronic
1157688496 18:49662122-49662144 CAGGAGTGGCCTCCCTGCACTGG + Intergenic
1160172955 18:76569553-76569575 ACGGAGTGGCCTCCAGCCACTGG + Intergenic
1162021239 19:7869514-7869536 CTGCCGTGGCCTCCCGCTACCGG - Exonic
1167863711 19:52306903-52306925 AAAGAGTGGCCTCACCCTCCAGG - Intronic
941327249 2:164131541-164131563 AAGGTGTGGGCTCCTGCCACAGG + Intergenic
941844412 2:170119099-170119121 AAGGAGTGGCCCCCAGGAACGGG - Intergenic
945128469 2:206539669-206539691 AAGAAGTGGGCTCCCTGTACTGG + Intronic
945407979 2:209473040-209473062 AAGGAGTAGCGTCCTGCTCCTGG - Intronic
1172622836 20:36331088-36331110 ATGGGGTGGCCTCCCCCCACAGG - Intronic
1175618075 20:60420457-60420479 AAGGAGTGCCCTCCAGGTTCAGG - Intergenic
1178574553 21:33773592-33773614 ATGCAGTGGCCTCCAACTACTGG - Intronic
1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG + Intronic
1183828364 22:40405401-40405423 AAGGAGTGGCCTCCCACTCCGGG + Intronic
950040910 3:9918446-9918468 AAGGCCTGGCCTGCCGCTCCTGG + Intronic
961739569 3:129024696-129024718 CAGGAGTGGGCTCCAGATACAGG - Intronic
968008665 3:195259554-195259576 AGGGAGAGGCCTCCCGCCCCAGG + Intronic
985925976 5:3019301-3019323 GAGGAGTGGGCTCCTTCTACAGG + Intergenic
1001181145 5:169521859-169521881 ACCGAGTGGCCCCACGCTACAGG + Intergenic
1003116732 6:3288371-3288393 AAGGGGTGGCTTCCCCCTATGGG - Intronic
1009623487 6:66105603-66105625 AAGGCGTGGCCTGACGCTCCTGG + Intergenic
1011295699 6:85825056-85825078 ATGGGGTGGGCTCCAGCTACTGG - Intergenic
1016616226 6:146051664-146051686 AAGGACTGGCTCCCCGCTGCAGG - Intronic
1019883316 7:3882400-3882422 AAAGAGGGGCCTCCCGCATCAGG - Intronic
1027412871 7:77940821-77940843 AAGTAGTGGGCTCCCTCTGCTGG - Intronic
1029166447 7:98594850-98594872 AAGGGGTGGGCTCCTGCTGCAGG + Intergenic
1035242021 7:157538397-157538419 AAGCAGTGCCCTCCAGCTAGAGG - Intergenic
1037593977 8:20338611-20338633 AAGGTGTGGCCTTCCTCAACAGG - Intergenic
1049741208 8:144241870-144241892 AAGGAGTGGGCCCCTGCTGCAGG + Intronic
1188310768 X:28613731-28613753 AAGGAGTCACCTCCAGCCACGGG + Intronic
1192150132 X:68706950-68706972 AAGGAGTCGCCTACCACTGCAGG - Intronic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1201735577 Y:17256928-17256950 AAGGAGTGGTCTCCTGCACCAGG - Intergenic