ID: 1183830810

View in Genome Browser
Species Human (GRCh38)
Location 22:40417550-40417572
Sequence CCTTGTAGGGGGCGGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 1, 2: 11, 3: 73, 4: 722}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183830797_1183830810 2 Left 1183830797 22:40417525-40417547 CCAGGGGGCTGGGGGTGCAGACC 0: 1
1: 0
2: 29
3: 81
4: 526
Right 1183830810 22:40417550-40417572 CCTTGTAGGGGGCGGGGGGCGGG 0: 1
1: 1
2: 11
3: 73
4: 722
1183830796_1183830810 9 Left 1183830796 22:40417518-40417540 CCAGTGGCCAGGGGGCTGGGGGT 0: 1
1: 0
2: 6
3: 66
4: 559
Right 1183830810 22:40417550-40417572 CCTTGTAGGGGGCGGGGGGCGGG 0: 1
1: 1
2: 11
3: 73
4: 722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183830810 Original CRISPR CCTTGTAGGGGGCGGGGGGC GGG Intronic
900110404 1:1003107-1003129 CCTGGCAGGGGGCAGGGAGCAGG - Intergenic
900170754 1:1267587-1267609 CCTTGAGGGGGGCGGGGTCCAGG - Intronic
900178638 1:1301916-1301938 CCTTGGAGGGGAAGGGGGTCTGG - Intronic
900626678 1:3611645-3611667 CCGTGCCGGGGGCGGGGCGCTGG - Intergenic
900746540 1:4364674-4364696 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
900943192 1:5814402-5814424 CTTTGCAGGGGGCGGGTGGCAGG + Intergenic
901066652 1:6497469-6497491 CCGCCTCGGGGGCGGGGGGCGGG + Intronic
901238752 1:7680978-7681000 CCACGTTGGGGCCGGGGGGCAGG + Intronic
901637157 1:10675793-10675815 CTTTGTTGGGGGTGGGGGGGGGG - Intronic
901639099 1:10684349-10684371 CCTTGGAGGGGGCGGGGAGCGGG + Intronic
901813713 1:11782096-11782118 CCTGGTAGGGGGCGAAGGGCTGG + Intronic
902612089 1:17603306-17603328 CCTTGGAGGGGGTGGGGGGCGGG + Intronic
902622280 1:17657467-17657489 CCTTCCAGGGGACTGGGGGCTGG - Intronic
903139952 1:21333331-21333353 CCGTGGGGGGGGCGGGGGGGTGG + Intronic
903417324 1:23192888-23192910 GGTGGTGGGGGGCGGGGGGCAGG - Exonic
903767938 1:25746797-25746819 CCTCGGCGGGGGAGGGGGGCGGG + Intronic
903793017 1:25906960-25906982 CGGTGTAGGGTGCCGGGGGCAGG - Intronic
903867916 1:26411839-26411861 CCTGGGAAGGGGCAGGGGGCAGG + Intronic
904080944 1:27872403-27872425 TACTGCAGGGGGCGGGGGGCGGG + Intergenic
904755069 1:32764211-32764233 CTTTGGTGGGGCCGGGGGGCGGG - Intronic
904840395 1:33368535-33368557 CCTGGGCGGGGGTGGGGGGCCGG + Exonic
905172734 1:36118677-36118699 GCTGGTTGGGGGTGGGGGGCGGG - Intronic
905310340 1:37044526-37044548 CCTTGGAGGTGGAGTGGGGCTGG - Intergenic
905553044 1:38859371-38859393 CCGGGGAGGGGGCGGGGGACTGG + Intronic
905896461 1:41549022-41549044 CCTGTTGGGGGGTGGGGGGCAGG - Intronic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906210569 1:44010447-44010469 CCTTGTGGGCGGGGGGGGGGGGG + Intronic
906279344 1:44542874-44542896 CCTTGAGTGGGGCTGGGGGCCGG + Intronic
906535842 1:46550520-46550542 CCTGGGCGGGGGCGGGGGGTGGG + Intronic
908354293 1:63316545-63316567 CCTTGTGTGGGGCGGGGGAGGGG - Intergenic
908685120 1:66709179-66709201 GCCTGTCGGGGGTGGGGGGCTGG - Intronic
909260735 1:73486442-73486464 CCTCTCAGGGGGTGGGGGGCTGG - Intergenic
909698051 1:78489696-78489718 CCTGTTAGGGGGTGGGGGGCAGG + Intronic
910328534 1:86040462-86040484 CCTTGTAGGGGTGGGGGGAGGGG - Intronic
911265361 1:95736884-95736906 CTTTGTGGGGGCCGCGGGGCTGG - Intergenic
911664674 1:100539395-100539417 CCTGGTAGGTGGCGGGCGCCCGG - Exonic
911991229 1:104699119-104699141 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
912574881 1:110659919-110659941 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
912615456 1:111095820-111095842 CCTTTCAGGGGCTGGGGGGCTGG + Intergenic
912632672 1:111259803-111259825 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
913020399 1:114783847-114783869 CCTGTTGGGGGGTGGGGGGCAGG - Intergenic
913027860 1:114863965-114863987 CCTGTTGGGGGGTGGGGGGCAGG + Intronic
913449040 1:118979947-118979969 CCTTGGAGGCGCCGCGGGGCCGG - Intronic
914076756 1:144359980-144360002 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
914102422 1:144606517-144606539 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
914171203 1:145225556-145225578 CCTTTCAGGGGGTGGGGGGCTGG - Intergenic
914296474 1:146330681-146330703 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
914526312 1:148469529-148469551 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
914864309 1:151413597-151413619 GGGTGTAGGGGGCTGGGGGCGGG - Intronic
914999310 1:152573573-152573595 CCTGGTAGTAGGCGGGGGGGCGG + Intronic
915116345 1:153603064-153603086 TCTTGTTGGTGGCGGGGGGAGGG - Intergenic
915164322 1:153940201-153940223 CCTTGTAGGGTCTGCGGGGCAGG + Exonic
915310540 1:155003993-155004015 GGTTGTGCGGGGCGGGGGGCAGG - Intronic
915453141 1:156020735-156020757 CCTTGCAAGAGGCGGGAGGCGGG - Intronic
915528050 1:156488162-156488184 CCTTGTGGGTGGCAGGGGGTTGG + Intronic
915709144 1:157877375-157877397 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
915711905 1:157907822-157907844 GCCTGTTGGGGGTGGGGGGCTGG + Intergenic
915725584 1:158014675-158014697 CTTTATGGGGGGGGGGGGGCGGG + Intronic
915972918 1:160366877-160366899 CCTGGGTGGGGGCGGGGAGCGGG - Intergenic
916635881 1:166667971-166667993 GCCTGTCGGGGGTGGGGGGCTGG + Intergenic
917455330 1:175181228-175181250 ATTTGTGGGGGGCGGGGGGCTGG + Intronic
917793358 1:178513925-178513947 GGTTGTGGGGGGCAGGGGGCAGG + Intronic
917933499 1:179840737-179840759 CCTGTCAGGGGGTGGGGGGCTGG + Exonic
918846510 1:189621930-189621952 CCTTTTGGGGGGCAGGGGGAAGG + Intergenic
919455302 1:197813926-197813948 GGTTGTGGGGTGCGGGGGGCGGG + Intergenic
920146199 1:203863184-203863206 TTTTTTGGGGGGCGGGGGGCGGG + Intronic
920312031 1:205054225-205054247 CCTTGCAGGGGGTGTGGGGTAGG - Intronic
920666836 1:207969208-207969230 CTTTGCAGGAGGTGGGGGGCGGG + Intergenic
921236575 1:213137827-213137849 CCTTGGTGGGGGTGGGGGGAAGG - Intronic
921498890 1:215875987-215876009 CTATGGAGGGGGCGGGGGGAAGG + Intronic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922130470 1:222772239-222772261 TTGTGTGGGGGGCGGGGGGCGGG + Intergenic
922718043 1:227887160-227887182 CCGGGCAGGGGGCGGGGGACTGG + Intergenic
924160140 1:241222812-241222834 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
924302621 1:242654774-242654796 CCTGTCAGGGGGTGGGGGGCGGG + Intergenic
924820726 1:247487780-247487802 TGTTGTGGGGGGCGGGGGGCGGG + Intergenic
924864912 1:247968492-247968514 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1063096221 10:2911368-2911390 CCAAGTAGGGAGCGGGAGGCAGG + Intergenic
1063372291 10:5529695-5529717 CCTTTTTGGGGGCTGAGGGCAGG - Intergenic
1063512878 10:6663331-6663353 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1063948941 10:11204539-11204561 CCTTGTCGGGGGCCGGTGGGGGG + Intronic
1065214718 10:23438928-23438950 CGCGGTAGGGGGCGGGGCGCGGG + Intergenic
1065288693 10:24209097-24209119 CCTGGGAGGGGGCCCGGGGCTGG - Intronic
1067013009 10:42732039-42732061 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1067080722 10:43210855-43210877 CCTTGCAGGGAGTGGGGGACAGG + Intronic
1067080751 10:43210983-43211005 CCTTGCAGGGAGTGGGGGACAGG + Intronic
1067310831 10:45112077-45112099 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1067379403 10:45759292-45759314 CTTTGTCGGGGGTGGGGGGGGGG - Intronic
1067887104 10:50099955-50099977 CTTTGTCGGGGGTGGGGGGGGGG - Intronic
1067898823 10:50216150-50216172 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1069438334 10:68406684-68406706 CCTTGCTGGGGGGAGGGGGCAGG - Intronic
1069557779 10:69408865-69408887 GCCTGGAGGGGGCGGGGGGCTGG - Intronic
1069573891 10:69511933-69511955 CCTTTCAGAGGGTGGGGGGCTGG + Intergenic
1069591779 10:69646384-69646406 CCGTGCTGGGGGCTGGGGGCTGG + Intergenic
1070007722 10:72441398-72441420 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1070736714 10:78868050-78868072 GGTAGTAGGGGGTGGGGGGCGGG - Intergenic
1071553485 10:86585177-86585199 ACCTGTAGGGAGCTGGGGGCTGG - Intergenic
1072190445 10:93073241-93073263 CCTTGCAGGGGTTGGGGAGCTGG + Intergenic
1072219506 10:93315765-93315787 CCTTGGAGGGGGTGGTTGGCGGG + Intronic
1072275726 10:93820857-93820879 CCTTGTTGGGGCCAGGGGGCGGG - Intergenic
1072290653 10:93961610-93961632 CCCTGGAGGGGGCGGGGAGGGGG - Intergenic
1073125361 10:101145878-101145900 GCTGGTGGGGGGCGGGGGGAGGG + Intergenic
1073288554 10:102402384-102402406 CCGGGAAGGGGGCTGGGGGCAGG - Exonic
1073292177 10:102418856-102418878 CCTGGGAGAGGGCGGGGGGTGGG - Exonic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1073978746 10:109130124-109130146 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1074095105 10:110304747-110304769 CCTTGTGTGGGGCTGGGGGCGGG + Exonic
1075088548 10:119430144-119430166 GCTTGCAGGGGGCTGGGGGCTGG + Intronic
1075131508 10:119743640-119743662 GGTTGCTGGGGGCGGGGGGCGGG + Intronic
1075298254 10:121297071-121297093 ACTTGGTGGGGGCCGGGGGCTGG - Intergenic
1076344971 10:129773721-129773743 CTTGGGAGGGGGCTGGGGGCCGG - Intergenic
1076702138 10:132279039-132279061 CCATGCAGGGGGCGGGGGACGGG + Intronic
1077144921 11:1040495-1040517 CCTTGGAGGGAGGGTGGGGCAGG - Intergenic
1077252972 11:1568760-1568782 CCTCTGAGGGGGCGGGGAGCCGG - Intronic
1077377389 11:2211447-2211469 CCTTGTGGGGTGGGGGGAGCTGG - Intergenic
1077646951 11:3933695-3933717 CATTGTAGACGGCGGGCGGCGGG - Intronic
1077655070 11:4010867-4010889 GCCTGTTGGGGGCTGGGGGCTGG - Intronic
1078592827 11:12659979-12660001 CCTTGTAGGGGAAGCAGGGCAGG + Intergenic
1078690550 11:13575750-13575772 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
1078875296 11:15388882-15388904 CCTGTTAGGGGGTGGGAGGCTGG - Intergenic
1079251976 11:18793167-18793189 CCGTCTCGGGGGCGGGGGGGTGG - Intergenic
1079510014 11:21199794-21199816 CCTATTGGGGGGTGGGGGGCTGG - Intronic
1079585618 11:22123462-22123484 CCTTTTCGGGGGTGGGGGTCTGG + Intergenic
1080107830 11:28529596-28529618 CATAGCAGGGGGTGGGGGGCGGG + Intergenic
1080589414 11:33708456-33708478 CTTTTTTGGGGGCGGGGGGGTGG - Intronic
1081162175 11:39762585-39762607 ACTTGTGGGGGGAGGGGGGAGGG + Intergenic
1081314245 11:41612111-41612133 CCTTGTGGGGTGTGGGGAGCGGG + Intergenic
1081411230 11:42760640-42760662 TTTTTTGGGGGGCGGGGGGCAGG - Intergenic
1081537310 11:44005208-44005230 CCAGGCAGGGGGCTGGGGGCAGG - Intergenic
1081621266 11:44620269-44620291 CCTTGTAGGGGGAGAGGGGAGGG + Exonic
1081683583 11:45025949-45025971 CATGGCAGGAGGCGGGGGGCAGG + Intergenic
1081828955 11:46089797-46089819 TTTTGGAGGGGGTGGGGGGCGGG + Intronic
1081990953 11:47337348-47337370 CTGGGGAGGGGGCGGGGGGCAGG + Intronic
1082140070 11:48598761-48598783 CCTTTTGTGGGGCGGGGGGAGGG - Intergenic
1082824288 11:57566944-57566966 TCTAGGAGGGGGGGGGGGGCGGG - Intronic
1083148657 11:60776408-60776430 GATGGTAGGGGGTGGGGGGCGGG - Exonic
1083300802 11:61738825-61738847 CGGGGCAGGGGGCGGGGGGCAGG - Intronic
1083445732 11:62707032-62707054 GCGTGAAGGGGGCGGGGGGATGG - Intronic
1083992963 11:66257992-66258014 CCTGGTAGGGGGCGCGGTCCCGG + Intronic
1084603227 11:70158840-70158862 CCTCGGTGGGGGCTGGGGGCTGG + Intronic
1084978384 11:72815508-72815530 CCTGGGTCGGGGCGGGGGGCAGG - Intronic
1085609310 11:77932951-77932973 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1086531032 11:87785231-87785253 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1086545469 11:87962489-87962511 GCTTGGCGGGGGCAGGGGGCAGG + Intergenic
1086645554 11:89215363-89215385 CCTGTTTGGGGGTGGGGGGCTGG + Intronic
1086720380 11:90113999-90114021 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1087422627 11:97949559-97949581 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1087898824 11:103617303-103617325 CCTATCAGGGGGTGGGGGGCTGG + Intergenic
1088381226 11:109194787-109194809 CCTGTCAGGGGGCAGGGGGCAGG - Intergenic
1088410163 11:109525365-109525387 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1089934790 11:122352885-122352907 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1089935129 11:122356872-122356894 CCTGGTGGGGGGAGGGGGGAGGG - Intergenic
1089938337 11:122388959-122388981 CCTTTTGGGGGGTGGGGGGTTGG - Intergenic
1090120165 11:124018349-124018371 CCTTTTGGGGGGTGGGGGGCTGG - Intergenic
1090189898 11:124760802-124760824 CCTTGTGGGGGGTGGGGGCTGGG - Intronic
1091190658 11:133693088-133693110 CCAGGGTGGGGGCGGGGGGCGGG - Intergenic
1091290128 11:134434838-134434860 GTTGGTTGGGGGCGGGGGGCAGG + Intergenic
1091399785 12:174934-174956 GGTTGTAGGGGGGTGGGGGCGGG - Exonic
1091421872 12:348754-348776 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1091517015 12:1194946-1194968 ATTTTTTGGGGGCGGGGGGCAGG + Intronic
1091532632 12:1374380-1374402 CCCTGTAGGGGGTGGGGGGGCGG - Intronic
1092072281 12:5641217-5641239 CCTGTCAGGGGGTGGGGGGCAGG + Intronic
1092143583 12:6200229-6200251 CCTGGGCGGGGGCGGGGGGCGGG + Intronic
1092513836 12:9186843-9186865 GCCTGTCGGGGGTGGGGGGCTGG + Intronic
1092604994 12:10108836-10108858 CCTGTTGTGGGGCGGGGGGCAGG + Intronic
1093678170 12:21968197-21968219 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1095222690 12:39635636-39635658 CCTGTTGGTGGGCGGGGGGCTGG + Intronic
1095672540 12:44876907-44876929 CCCTGCCGGGGGCGGGGCGCTGG + Exonic
1095957787 12:47816744-47816766 CCTTGTAGGAGGAGGGAGACTGG + Intronic
1095967632 12:47879537-47879559 CCTTGGAGGGGGCGTTGGGCAGG - Intronic
1096185493 12:49577877-49577899 TATTGCAGGGGGCGGGAGGCAGG - Intronic
1096241343 12:49961826-49961848 CTATATAGGGGGCGGGCGGCCGG - Intergenic
1096630890 12:52926141-52926163 GGTGGTGGGGGGCGGGGGGCAGG - Intronic
1096735054 12:53646695-53646717 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1096778024 12:53975427-53975449 CCCTTTTGGGGGCGGGGGGAGGG + Exonic
1097000632 12:55873495-55873517 ATTTGTGGGGGGCGGGGAGCTGG + Intergenic
1097135100 12:56846315-56846337 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1097679827 12:62637979-62638001 CCTGGTTGGGGGCGGGGGGGGGG + Intergenic
1099224312 12:79950781-79950803 TTTTGTAGGGGGGTGGGGGCAGG + Intergenic
1099409725 12:82310638-82310660 CCTGTTGGGGGGCGGGGGGCTGG - Intronic
1099523158 12:83688940-83688962 GCTGGTCGGGGGTGGGGGGCTGG + Intergenic
1100073383 12:90749617-90749639 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1100381905 12:94070244-94070266 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1100490459 12:95073327-95073349 CCGCGTCGGGGGCGGGGGCCAGG - Intronic
1101843891 12:108346372-108346394 CCTGGGAGGGGTCGGAGGGCTGG + Intergenic
1102222295 12:111202674-111202696 CATTGGAGGGGGCAGGAGGCGGG + Intronic
1102492146 12:113295893-113295915 CCTTGTGGGGTGGGCGGGGCAGG + Intronic
1103201105 12:119088660-119088682 CCTTTTGGGGGGCGTGGGGGTGG + Intronic
1103527749 12:121579213-121579235 ACATTTCGGGGGCGGGGGGCAGG - Intronic
1104072243 12:125355989-125356011 GTTTGGAGGGGGCTGGGGGCTGG + Intronic
1104406462 12:128521452-128521474 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1106740820 13:32639036-32639058 CATTGTGGGGGGTGGGGGGGTGG - Intronic
1106967623 13:35090260-35090282 CATTGTAGGAGGCGGGGAGAGGG + Intronic
1107833958 13:44398695-44398717 CTTTGCAAGGGGCTGGGGGCTGG - Intergenic
1108142918 13:47444758-47444780 GGTGGTAGGGGGCAGGGGGCAGG + Intergenic
1108188617 13:47913942-47913964 CCTGTTGGGGGGCTGGGGGCTGG + Intergenic
1108412793 13:50166943-50166965 CCTGTTAGGGGGTGGGGGGCTGG + Intronic
1109571211 13:64192707-64192729 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1109809639 13:67495271-67495293 CCTTGTTTGGGGCAGGGAGCAGG - Intergenic
1111646619 13:91039415-91039437 CCTTTAAGGGGGTGGGGGGAGGG + Intergenic
1112042891 13:95565773-95565795 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1112365855 13:98754818-98754840 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1113036999 13:106061812-106061834 GATTTTAGGGGGCGGCGGGCAGG - Intergenic
1113209640 13:107960539-107960561 CTTTGCAGGGGGCTGGGGGATGG + Intergenic
1113699830 13:112376181-112376203 TCTTGCCAGGGGCGGGGGGCAGG - Intergenic
1113778839 13:112964096-112964118 GGTTGCAGGGGGCGGGGGGGCGG + Intronic
1114270718 14:21098444-21098466 CCGGGGAGGGGGCGGGGGCCGGG - Exonic
1114450639 14:22822767-22822789 CCTTGTTGGGGGGGCGGGGGCGG + Intronic
1114928611 14:27437732-27437754 CCTTGTAGAGGGTGGAGGGTGGG + Intergenic
1115035436 14:28851206-28851228 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1115167605 14:30466526-30466548 GCCTGTTGGGGGTGGGGGGCGGG - Intergenic
1115473118 14:33788970-33788992 TCTTGGTGGGGGTGGGGGGCGGG + Intronic
1115474357 14:33799713-33799735 CTCTGTGTGGGGCGGGGGGCCGG - Exonic
1116403744 14:44542499-44542521 CCTGTCATGGGGCGGGGGGCAGG + Intergenic
1116426588 14:44798899-44798921 CGGGGTACGGGGCGGGGGGCGGG - Intergenic
1116471942 14:45295595-45295617 TGTTGTGGGGAGCGGGGGGCGGG + Intergenic
1117123129 14:52590979-52591001 CCTATAAGGGGGTGGGGGGCTGG - Intronic
1117995571 14:61474549-61474571 CCTGGCAGGGGATGGGGGGCTGG + Intronic
1118366760 14:65102724-65102746 CCGGGGAGGGGGGGGGGGGCGGG + Intergenic
1118777143 14:68979877-68979899 CCTTGTAGGGTGGGGTGGGGTGG - Intergenic
1118836760 14:69483794-69483816 CCTGGCAGGTGGCGCGGGGCAGG + Intergenic
1119457620 14:74769860-74769882 ACTTTTTGTGGGCGGGGGGCGGG - Intronic
1119552111 14:75522567-75522589 ACCTGTAGGGGGTGGTGGGCTGG + Exonic
1120090698 14:80329731-80329753 CCTAGTGTGGGGTGGGGGGCTGG + Intronic
1120398264 14:83995821-83995843 GCATGTGGGGGGCAGGGGGCGGG - Intergenic
1121629731 14:95413496-95413518 CCTTGCAGGGGATGGGAGGCTGG - Intronic
1122275196 14:100587419-100587441 CCGGGCTGGGGGCGGGGGGCGGG - Intergenic
1122985702 14:105210704-105210726 CCTGGCGGGGCGCGGGGGGCTGG - Intronic
1123625581 15:22224859-22224881 CCTTGACGGGGGCGGGGTGGGGG - Intergenic
1124500992 15:30225904-30225926 CCACCTAGAGGGCGGGGGGCGGG - Intergenic
1124742577 15:32312763-32312785 CCACCTAGAGGGCGGGGGGCGGG + Intergenic
1124798342 15:32804658-32804680 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1125363885 15:38893009-38893031 GCCTGTTGGGGGTGGGGGGCAGG + Intergenic
1125371591 15:38983778-38983800 CCTGGATGGGGGCGGGGGGCGGG + Intergenic
1126237253 15:46400475-46400497 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1126336432 15:47590373-47590395 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1127309435 15:57739322-57739344 CCTGTTGGGGGGAGGGGGGCAGG + Intronic
1127686199 15:61347400-61347422 CCTGTTGGCGGGCGGGGGGCTGG + Intergenic
1128151051 15:65363652-65363674 CCTGGCAGGAGGCGGGTGGCGGG - Intronic
1128249014 15:66151950-66151972 CCTGCCATGGGGCGGGGGGCAGG + Intronic
1128486819 15:68100477-68100499 CCTTTTAAGGGGCGGGGAGGGGG + Intronic
1128523921 15:68395718-68395740 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1128612922 15:69088215-69088237 CAATGAAGGGGGCGTGGGGCTGG - Intergenic
1128841179 15:70853215-70853237 CCTTGCGGGGGGCGGGGGGGGGG - Intronic
1129116791 15:73369013-73369035 GCTGGAAAGGGGCGGGGGGCGGG + Exonic
1129339244 15:74874026-74874048 CCCTGTGGGGGGCGGGGGCGGGG - Intergenic
1129664350 15:77571320-77571342 TCCCCTAGGGGGCGGGGGGCAGG - Intergenic
1129784956 15:78303981-78304003 TCTTGGAGGGGGCTGGGAGCAGG + Intergenic
1131046935 15:89322416-89322438 CCCTGTTGGGGGCTGGGAGCTGG - Intronic
1131144159 15:90000855-90000877 CCTTGGGGGGGGCGGGGCGCAGG + Intergenic
1131917031 15:97278878-97278900 CCTATCAGGGGGTGGGGGGCGGG - Intergenic
1131941386 15:97570004-97570026 TCTTGTTCGGGGCTGGGGGCTGG - Intergenic
1132508422 16:324326-324348 CCTGGGAGGAGGCTGGGGGCCGG + Intronic
1132648512 16:1010022-1010044 CCTCGTGTGGGGCGGGGGCCGGG + Intergenic
1132828993 16:1918440-1918462 CCTGGGAGCGGGCGCGGGGCGGG + Exonic
1132857659 16:2054120-2054142 CATTGTACAGGGCAGGGGGCCGG - Intronic
1133030274 16:3007616-3007638 ACTTGCAGGGGGCAGCGGGCTGG - Intergenic
1133285924 16:4690788-4690810 CCTTGGTGGGGGCGGGGGGCGGG - Exonic
1133475381 16:6116262-6116284 CCTGTCAGGGGGTGGGGGGCAGG + Intronic
1133499812 16:6355282-6355304 CCTGTTAGGGGCTGGGGGGCTGG - Intronic
1133641111 16:7718234-7718256 CTTTGCGGGGGGCGGGGGGGGGG + Intergenic
1133650191 16:7805504-7805526 CCTTCAGGGGGGCGGGGGGGTGG + Intergenic
1134257294 16:12622749-12622771 CTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1135319544 16:21483083-21483105 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1135372381 16:21914571-21914593 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1135439405 16:22456137-22456159 CACTCTAGGGGGCGGGGGGAAGG - Intergenic
1135735840 16:24931216-24931238 GCTGGGAGGGGGCGGAGGGCTGG + Exonic
1135922950 16:26667629-26667651 CCCTGTAGGTGGCAGGGGTCAGG - Intergenic
1136294097 16:29291949-29291971 GCTTGTTGGGGGTGGGGAGCTGG - Intergenic
1136329776 16:29564805-29564827 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1136444403 16:30304509-30304531 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1137686184 16:50388559-50388581 CCCTGTAGGGGTTGGTGGGCAGG + Intergenic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1139299297 16:65931396-65931418 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1139364962 16:66427428-66427450 CCGAGTAAGGGGCGTGGGGCTGG + Exonic
1139420003 16:66844329-66844351 CCTGCTGGGGGGTGGGGGGCGGG + Intronic
1139847148 16:69929238-69929260 CCTTGTTGGTGGTGGGGGGCGGG - Intronic
1140809730 16:78565899-78565921 CAATGTTGGGGGCGGGGGGCGGG - Intronic
1141694014 16:85611602-85611624 CCTTGTGCAAGGCGGGGGGCCGG + Intronic
1141988347 16:87594434-87594456 CCTTGGGTGGGGTGGGGGGCCGG + Intergenic
1142100000 16:88265995-88266017 GCTTGTTGGGGGTGGGGAGCTGG - Intergenic
1142151841 16:88516065-88516087 CCTCGTAGGGTGCGGGGAGGAGG - Intronic
1142263467 16:89053091-89053113 CGTTGGGGGAGGCGGGGGGCTGG - Intergenic
1142638294 17:1271012-1271034 CCCTGCAGGCGGCGGGGGGCTGG - Exonic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1142795266 17:2302803-2302825 CTTGGTGGGGGGCGGGGGGATGG + Intronic
1142804790 17:2365695-2365717 TCTTGTAGGGGTTGGGGAGCAGG - Intronic
1143211829 17:5193666-5193688 GCTGGTGGGGGGTGGGGGGCTGG + Intergenic
1143514298 17:7411657-7411679 CCTTGTGGGGGGCGGCAGGCAGG + Intronic
1143592767 17:7895444-7895466 CCTTGAAGAGGACGGGGGGGTGG - Exonic
1144092732 17:11872364-11872386 CATTGCAGGGGGTGGGGGGCGGG - Intronic
1144113607 17:12063965-12063987 TCTGTCAGGGGGCGGGGGGCGGG + Intronic
1144417781 17:15068290-15068312 CTTTTTGGGGGGAGGGGGGCAGG + Intergenic
1144757084 17:17686311-17686333 GCTTGGTGGGGTCGGGGGGCAGG + Intronic
1145196510 17:20898913-20898935 CCCTGCGGGGGGCGGGGGGGAGG + Intergenic
1146607697 17:34275434-34275456 CCTTTTGGAGGGTGGGGGGCTGG - Intergenic
1146935383 17:36809717-36809739 CCTGGTAGGTGGGGGAGGGCAGG + Intergenic
1147137754 17:38443893-38443915 ACTCCTGGGGGGCGGGGGGCAGG + Intronic
1147382219 17:40062774-40062796 CGCGGCAGGGGGCGGGGGGCGGG + Intronic
1147517731 17:41138051-41138073 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1147605943 17:41773680-41773702 AATGGTGGGGGGCGGGGGGCGGG + Intronic
1147652754 17:42071709-42071731 CCTAGGAGGGGGCATGGGGCCGG - Intergenic
1147967086 17:44199433-44199455 GCCTGTGGGGGGCGGGGGGCGGG - Intronic
1148247923 17:46047615-46047637 CTTTGTAGGGGGCGGGAGGCGGG + Intronic
1148645453 17:49217586-49217608 CCTGGTGGGGGGCGGGGGGCGGG + Intronic
1148852445 17:50561530-50561552 ACCTGTCGGGGGCCGGGGGCCGG + Exonic
1148864954 17:50623640-50623662 TTTTGCAGGGGGTGGGGGGCAGG + Intronic
1150198296 17:63325053-63325075 CTTTGTGTGGGGTGGGGGGCGGG + Intronic
1150209576 17:63434732-63434754 GCTGGTTGGGGGCGGGGGGATGG - Intronic
1150321859 17:64221194-64221216 CCTGTCAGGGGGCAGGGGGCAGG + Intronic
1150509147 17:65730763-65730785 CTTGGTTGGGGGCGGGGGGTGGG - Intronic
1151278690 17:73055625-73055647 GCGGGTAGGGGGCGAGGGGCAGG + Intronic
1151577861 17:74961989-74962011 CCTTGTAGGAGGAAGGGGGAGGG + Exonic
1152033341 17:77857088-77857110 CCTTGTTGGGGGCTGGGGAGGGG + Intergenic
1152042504 17:77913645-77913667 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1152218344 17:79047383-79047405 CGTGGCAGGGGGCTGGGGGCAGG + Intronic
1152553419 17:81040974-81040996 CCCTCTAGGGGGCAGGAGGCTGG + Intronic
1152750602 17:82060814-82060836 CCTTGCAGGGGGTGAGGGGCTGG - Intronic
1152985207 18:314695-314717 CCTTGGAGGAGGCTGGAGGCTGG + Intergenic
1153039282 18:795748-795770 CCTGTTAGGGGGTGGGGGGAAGG + Intronic
1153222617 18:2875088-2875110 CCTTGAAGAGGGAGGGGTGCCGG + Intronic
1155524163 18:26699605-26699627 GTTTTTTGGGGGCGGGGGGCAGG - Intergenic
1155722899 18:29041304-29041326 CCTGTTGGGGGGTGGGGGGCGGG - Intergenic
1156434201 18:37108926-37108948 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1156474123 18:37394942-37394964 CCGGGTGGGGGGTGGGGGGCGGG - Intronic
1157300314 18:46474360-46474382 CCAGGTAGGGGGCAGGGGGTGGG + Intergenic
1157621249 18:49018562-49018584 CCTTGTAGGGTGCGAGGGGCAGG - Intergenic
1157700660 18:49759930-49759952 GTGTGTAGGGGGTGGGGGGCTGG + Intergenic
1157916600 18:51669705-51669727 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1158120226 18:54040613-54040635 TCTAGTGGGGGGCGGGGGGAAGG + Intergenic
1158517049 18:58139295-58139317 TCCTGTATGGGGCGGGGGTCGGG - Intronic
1158734169 18:60060995-60061017 CTTTCTAGGTGGAGGGGGGCGGG + Intergenic
1159392089 18:67806464-67806486 CCTGTTAGGGGGTGGGGGGTAGG + Intergenic
1159663247 18:71125423-71125445 CCTATTAGGGGGTGGGGGGCTGG + Intergenic
1159966047 18:74597430-74597452 CCTTACAGAGGGCGGGAGGCGGG + Intergenic
1160163318 18:76491534-76491556 ACATGACGGGGGCGGGGGGCGGG + Intronic
1160427499 18:78788157-78788179 CTTTGTGGGGGGCGGGGGTCGGG - Intergenic
1160507640 18:79436438-79436460 CCTGGAGGGTGGCGGGGGGCCGG + Intronic
1160513869 18:79467779-79467801 CCCTGTTGGGGGTGGGGGGCGGG + Intronic
1160605727 18:80048334-80048356 CAAGTTAGGGGGCGGGGGGCAGG - Intronic
1160609253 18:80073182-80073204 TCTGGTGGGGGGTGGGGGGCGGG - Intronic
1160734861 19:657883-657905 CCTTGGAGGAGGAGGGCGGCTGG - Intronic
1160830887 19:1104453-1104475 GCTTGCAGGGGGCGGGGTCCGGG + Intronic
1160979990 19:1812342-1812364 CCCGGAAGGGGGCCGGGGGCGGG + Intergenic
1161015144 19:1979640-1979662 CCTGGTAGGTGGGGGGGTGCCGG + Exonic
1161024955 19:2032503-2032525 CCTGGCAGGCGGCCGGGGGCAGG + Intronic
1161028259 19:2046517-2046539 CCCTGCAGGGGGGTGGGGGCCGG - Intronic
1161144698 19:2670746-2670768 ACTTGTGGGGGGCGGGGCGAGGG - Intronic
1161265029 19:3359992-3360014 CCGGGGAGGGGGCGGGGGCCCGG - Intronic
1161424920 19:4198253-4198275 CCAGGTAGGGGGCTGGGGGCTGG - Intronic
1161425337 19:4199806-4199828 CCCTGTCGGGGGCGTGGGGAGGG + Intronic
1161714435 19:5867309-5867331 CCTGGTGGGGGGCGGGAGGTTGG + Exonic
1161821907 19:6534853-6534875 CCTCGGAGGAGGCGGGTGGCAGG - Exonic
1162050421 19:8029201-8029223 CAGGGTGGGGGGCGGGGGGCAGG + Intronic
1162155683 19:8676818-8676840 CCTTGTGGGGGGCTCGGGGCAGG + Intergenic
1162312216 19:9914086-9914108 CCGCCTAGGGGGAGGGGGGCCGG - Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162818298 19:13208860-13208882 CCTTGTCGGGGGGCGGGGGATGG + Exonic
1162894793 19:13758846-13758868 CCTGGGAGGGAGCGGTGGGCAGG - Exonic
1163403769 19:17110174-17110196 CCTCGCGGGGGGCGGGGGTCAGG - Intronic
1163505640 19:17704409-17704431 CCGGGTGGGGGGTGGGGGGCGGG + Intergenic
1163832395 19:19553343-19553365 CCTTGTCCTGGGCGGGGGGGCGG - Intergenic
1164085057 19:21893836-21893858 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1165265613 19:34661116-34661138 GCCTGTCGGGGGTGGGGGGCTGG + Intronic
1165455294 19:35907387-35907409 CCTAGATGGGGGTGGGGGGCTGG - Intronic
1165777494 19:38413279-38413301 CATTGAAGGGGGAGGGTGGCTGG + Exonic
1165827318 19:38712767-38712789 CCATGTGGTGGGCAGGGGGCTGG - Intronic
1166299948 19:41907791-41907813 CCTGGGTGGGGGCTGGGGGCGGG + Intronic
1166354232 19:42217529-42217551 CCTTGCAGGGCGAGGGGGTCGGG - Intronic
1166836559 19:45670967-45670989 CCTTGAAGGGGGCGGGGTTTGGG + Intronic
1166861710 19:45815289-45815311 CCGTGGAGGGCGCGGGGAGCGGG + Exonic
1167382404 19:49146189-49146211 GCAGGTAGGGGGCGCGGGGCGGG + Exonic
1167802302 19:51752159-51752181 CCTTGGAGGGAGCAGGGGCCCGG - Intronic
1168014698 19:53563090-53563112 CCTTCTCGGGGACGGGGGGTGGG - Intronic
1168076468 19:53982990-53983012 CTTCGGAGGGGGAGGGGGGCGGG - Exonic
1168241089 19:55089224-55089246 CTTATTGGGGGGCGGGGGGCGGG - Intergenic
1168316170 19:55485678-55485700 CCTTCTGGGGGGCCGGGGCCTGG + Exonic
1168711710 19:58504571-58504593 CCTGGGGGGGGGGGGGGGGCGGG + Intronic
924982062 2:232590-232612 CCTTTCAGGGGGTTGGGGGCTGG - Intronic
925740200 2:6998887-6998909 CCTTGTGGGGGGTGGGGGCGGGG + Intronic
925927641 2:8681793-8681815 GCTGGCGGGGGGCGGGGGGCGGG - Intronic
926176433 2:10596251-10596273 GGTGGTGGGGGGCGGGGGGCGGG + Intronic
926622048 2:15055495-15055517 CCAGCTGGGGGGCGGGGGGCTGG + Intergenic
926649138 2:15322231-15322253 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
927117802 2:19922560-19922582 GCCTGTAGGGGGTGGGGGGCTGG + Intronic
927610226 2:24531604-24531626 CCTATCAGGGGGCGGGAGGCTGG - Intronic
927653253 2:24924931-24924953 CCATGGAGGGGACTGGGGGCAGG - Intergenic
928084387 2:28336736-28336758 ACTTGAAGGGGGCGGGCAGCCGG + Intronic
928426093 2:31179219-31179241 CCTGTCAGGGGGTGGGGGGCAGG - Intronic
928736783 2:34300582-34300604 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
930298703 2:49587693-49587715 CCTCTTGGGGGGTGGGGGGCTGG - Intergenic
931076882 2:58725226-58725248 GCTTGTTGGGGGTGGGGGGTCGG + Intergenic
931648057 2:64443228-64443250 CCTTGCTGGGGGCGGGGGGCAGG + Intergenic
932737060 2:74261642-74261664 GCTGGTAGGGGGCGGGGTGTGGG - Intronic
934572461 2:95381703-95381725 GGTAGTAGGGGGCTGGGGGCAGG + Exonic
935191112 2:100779585-100779607 ACTGGAGGGGGGCGGGGGGCGGG - Intergenic
935273342 2:101454046-101454068 GCCTGTCGGGGGTGGGGGGCTGG - Intronic
935503770 2:103873539-103873561 CCTTGATGGGGGGGGGGGGGCGG - Intergenic
936983099 2:118282363-118282385 CAATGTTGGGGGCGGGGGGATGG + Intergenic
937046027 2:118852380-118852402 CCTTGAAGGGGGTGAGGGACAGG + Intergenic
937101502 2:119274380-119274402 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
937335715 2:121061144-121061166 GATTGTAGGGGGCTGGGGGTAGG + Intergenic
937338604 2:121076895-121076917 ACTTGCGGGGGGCGGGGGGCGGG - Intergenic
937708442 2:124949366-124949388 TCTTGTTGGAGGCGGGGGACAGG - Intergenic
938254183 2:129841853-129841875 GCTTGTTGGGGGGTGGGGGCTGG - Intergenic
938867932 2:135443376-135443398 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
939851278 2:147308891-147308913 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
940260940 2:151779081-151779103 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
940720209 2:157273972-157273994 CCTTTTAGGGGGTGGGGGGCTGG - Intronic
940989982 2:160086981-160087003 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
940996367 2:160154426-160154448 CCTGTTATGGGGTGGGGGGCTGG + Intronic
941541030 2:166784654-166784676 CCCTCTGGGGGGTGGGGGGCGGG - Intergenic
941618886 2:167755023-167755045 TGTTGTAGGGGGCGGGGTGATGG + Intergenic
941773984 2:169371921-169371943 CCTGGTGGGTGGTGGGGGGCAGG + Intergenic
941818045 2:169817758-169817780 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
942311816 2:174663474-174663496 ACTTGCAGGGGGCGGCGGGGTGG - Intronic
942368221 2:175252523-175252545 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
942532174 2:176922915-176922937 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
942875173 2:180786492-180786514 CCTTTTGTGGGGTGGGGGGCAGG + Intergenic
942901797 2:181129067-181129089 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
944033329 2:195263950-195263972 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
944334055 2:198508633-198508655 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
944375292 2:199034429-199034451 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
944490864 2:200256479-200256501 TCTTCTGGGGGGCTGGGGGCTGG - Intergenic
944843118 2:203642957-203642979 CCACGGAGGGGGCGGGGGGGAGG + Intergenic
945895949 2:215481830-215481852 CCTTGTAGGGAGTGAGGGGCAGG + Intergenic
946088744 2:217200453-217200475 CTCTGTAGGGGGTGGGGGACTGG - Intergenic
946306522 2:218859744-218859766 CCGAGGCGGGGGCGGGGGGCAGG - Intergenic
946366867 2:219253941-219253963 CCTTATAGGCGGGGGGGGGGCGG + Exonic
947193448 2:227536167-227536189 GCCTGTCGGGGGTGGGGGGCTGG - Intronic
947220274 2:227785044-227785066 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
947720134 2:232365202-232365224 CCCTCTAGGGGGCTGGGGGTCGG - Intergenic
947732753 2:232440189-232440211 CCCTCTAGGGGGCTGGGGGTCGG - Intergenic
947940426 2:234049692-234049714 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
947970312 2:234317875-234317897 CGTTGTAGGTGGAGTGGGGCAGG + Intergenic
948075229 2:235160688-235160710 CCTTATAGGAGGAGGGAGGCAGG - Intergenic
948586971 2:239025808-239025830 GCCTGGGGGGGGCGGGGGGCGGG - Intergenic
948856857 2:240734272-240734294 CCTTGCAGGGAGAGGGGAGCGGG + Intronic
1168844868 20:937417-937439 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1169201190 20:3711012-3711034 AGTTGCGGGGGGCGGGGGGCGGG - Intergenic
1169440754 20:5631993-5632015 TTTTGTGGGGGGGGGGGGGCGGG + Intergenic
1169562507 20:6817264-6817286 CCTTTTGGAGGGTGGGGGGCTGG + Intergenic
1170464117 20:16607541-16607563 CCTTGTAGGGAGTGGTGAGCTGG - Intergenic
1170667206 20:18396902-18396924 CCTGGTAGGGGGCGGGGACAGGG + Intronic
1172183631 20:33018521-33018543 TCTTGCAGGGGCTGGGGGGCAGG + Intronic
1172232528 20:33346735-33346757 CCTTGTGGGGGGGGGGGGGGGGG + Intergenic
1172528971 20:35617623-35617645 CTTTGGAGGGGGTGGGGAGCAGG + Intronic
1172830385 20:37829102-37829124 CCATCTGGGGGGCAGGGGGCAGG + Intronic
1172867690 20:38112652-38112674 TGTTGTGGGGGGCGGGGGGTGGG + Intronic
1172949661 20:38714689-38714711 ACATGTGGGGGGCGGGGGGCTGG + Intergenic
1173353691 20:42267698-42267720 CTTTGTTGGGGGCCGGTGGCAGG - Intronic
1173571047 20:44076322-44076344 CCTGGTAGGTGGCGGGGGGGGGG - Intergenic
1173768893 20:45640599-45640621 CCTTCCAGAGGTCGGGGGGCAGG + Intergenic
1173961816 20:47079486-47079508 CCTTATAAGGGGTCGGGGGCAGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174207435 20:48850896-48850918 GCAGGCAGGGGGCGGGGGGCTGG - Intergenic
1174438958 20:50533441-50533463 CCAGGCTGGGGGCGGGGGGCAGG - Intronic
1174560981 20:51430548-51430570 CCTTGTAAGGCACGTGGGGCAGG + Intronic
1175026792 20:55910885-55910907 GCCTGTAGGGGGGTGGGGGCTGG + Intergenic
1175199156 20:57266285-57266307 CCGAGCAGGGGGCGGGGGTCCGG - Exonic
1175216268 20:57392965-57392987 CAAAGAAGGGGGCGGGGGGCAGG + Intronic
1175793507 20:61757235-61757257 CCCTGGAGGGGGCTGGGGGGGGG - Intronic
1175870756 20:62208398-62208420 CCTGGTAGGGGGCGGCAGGCTGG - Intergenic
1175971367 20:62688279-62688301 CCTCGTGGGGGGCCGCGGGCAGG - Intergenic
1175974893 20:62705837-62705859 CCTTGTGGGGGGCAGGGCTCCGG - Intergenic
1176377856 21:6095663-6095685 CCTTGGAGTGGGGTGGGGGCTGG - Intergenic
1176429523 21:6567337-6567359 ACTTGGAGGGGGTGGGGGGAGGG + Intergenic
1177819632 21:26016925-26016947 CTTTGTGGGGGGCGGGGGGCGGG + Intronic
1178985288 21:37298150-37298172 CCATGGAGGGGAAGGGGGGCAGG - Intergenic
1179704917 21:43174799-43174821 ACTTGGAGGGGGTGGGGGGAGGG + Intergenic
1179745618 21:43442585-43442607 CCTTGGAGTGGGGTGGGGGCTGG + Intergenic
1179923194 21:44518662-44518684 GCTGGTGGGGGGCAGGGGGCGGG - Exonic
1180005005 21:45016564-45016586 CCTTGGAGGGGGCGTTGAGCAGG + Intergenic
1180068227 21:45423491-45423513 CCCTCCGGGGGGCGGGGGGCGGG - Intronic
1180695654 22:17750056-17750078 CCTTGTGGGGGGCGGGGTCGAGG - Intronic
1180870530 22:19144267-19144289 CTTTGTATGGGACGGGGGTCAGG - Intronic
1180981349 22:19879540-19879562 TGTGGTGGGGGGCGGGGGGCGGG + Intronic
1181013159 22:20053998-20054020 CTTTGGAGGGGGAGGAGGGCAGG - Intronic
1181017254 22:20078332-20078354 TTTTGTAGGGGGTTGGGGGCCGG + Intergenic
1181230241 22:21417572-21417594 CCTTGTGGGGCGGGGGGCGCGGG + Intronic
1181592809 22:23895298-23895320 CGGTGTTGGGGGCGGGGGTCAGG + Exonic
1181631930 22:24156083-24156105 ACTTGGCGGGGGCGGGGGCCGGG + Intronic
1181667409 22:24407651-24407673 CCTTGCAGGGAGAGGGGGCCAGG - Intronic
1181988639 22:26820085-26820107 ACTGGTGGGGGGCGGGGGGTGGG - Intergenic
1183059737 22:35328710-35328732 CCTTGGAGGGGGCAGGGGACAGG + Intronic
1183143357 22:35965953-35965975 CATGGCAGGGGGCGGGGGGATGG - Intronic
1183647920 22:39137336-39137358 TCTTGTTGGGGTGGGGGGGCGGG + Intronic
1183668157 22:39256940-39256962 CCATGTAGGGTGCTGGGGGAGGG - Intergenic
1183830810 22:40417550-40417572 CCTTGTAGGGGGCGGGGGGCGGG + Intronic
1183831318 22:40419650-40419672 CCATGCTGGGGGCTGGGGGCTGG - Intronic
1184086581 22:42269742-42269764 GCCTGTTGGGGGCGGAGGGCAGG - Intronic
1184139795 22:42571925-42571947 GCCTGTTGGGGGCGGGGGGCGGG + Intronic
1184247394 22:43242546-43242568 CCTGGTAGGGGGCAGAGGCCGGG - Intronic
1184523676 22:45009477-45009499 CCAGGTAGGTGGCCGGGGGCCGG - Exonic
1184613729 22:45623454-45623476 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1184680736 22:46071186-46071208 CCTTGCCCGGGGCGGGCGGCGGG + Intronic
1184985141 22:48127196-48127218 CCTTTTGGGGGGTGGGGGGCAGG - Intergenic
1185080485 22:48707050-48707072 CCTTGGACAGGGCAGGGGGCAGG - Intronic
1185285870 22:49999699-49999721 CCTGGCCGGGGGCGGGGCGCGGG + Intronic
1185315669 22:50178212-50178234 TCTTGTCAGGGGCGGGCGGCGGG - Exonic
1185413412 22:50697479-50697501 CCGTGGAGGAGGCGGGGCGCGGG + Intergenic
950216256 3:11161863-11161885 TCCTGTAGGGGGCGGTGGGAAGG + Intronic
950274870 3:11651489-11651511 TCTTGGTGGGGGCGGGGGGTTGG - Intronic
950612909 3:14137518-14137540 CCTTGTGTGGGGGTGGGGGCTGG - Intronic
950690615 3:14652896-14652918 CCGTCTAAGGGGCGGGGGGCGGG + Intronic
950698941 3:14726773-14726795 CCAGGTAGGGGTAGGGGGGCAGG + Intronic
951012937 3:17701319-17701341 CCTGTTAGGGGGTAGGGGGCTGG + Intronic
951059980 3:18194681-18194703 CATTGTAGGGGCCAGGGGGAGGG - Intronic
951204184 3:19909031-19909053 CCTTGTAGGGGGTGGGGGGCGGG - Intronic
951481364 3:23165566-23165588 CTTTGAAGGGGATGGGGGGCAGG + Intergenic
951902153 3:27667343-27667365 CCCTGTGGGGGGGGGGGGGATGG - Intergenic
952449840 3:33421294-33421316 TCTTGCAGGGGGCGGGGGCGGGG + Intronic
952457118 3:33483805-33483827 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
952740038 3:36725963-36725985 CCTTGTTGGGGGAGGAGGACAGG - Intronic
952827670 3:37537657-37537679 CATTCTAGTGGGAGGGGGGCAGG + Intronic
953413526 3:42702853-42702875 CCTTGAAGGGGGGCGGGTGCTGG + Intronic
953573683 3:44095514-44095536 GCCTGTAGGGGTTGGGGGGCTGG - Intergenic
954894372 3:53963450-53963472 CCTTCAAGGGGGCGGGTGTCAGG + Intergenic
955289242 3:57675630-57675652 CCTTGCAGGGGCTGTGGGGCAGG - Intronic
955433011 3:58870086-58870108 CCTTGTAGAGGGAGGGAGGGAGG - Intronic
955848632 3:63195347-63195369 CCTTGGAGGAGGTGGGGGGTAGG + Intergenic
955950653 3:64239235-64239257 CCTGCTGGGGGGCGGGGGGCTGG + Intronic
956182112 3:66527284-66527306 CTCTGTATGGGGTGGGGGGCGGG + Intergenic
956396036 3:68827033-68827055 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
956675102 3:71725501-71725523 CCCTGAAGGCGGCGGGCGGCGGG - Intronic
957899857 3:86475099-86475121 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
958259686 3:91366264-91366286 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
958520384 3:95179127-95179149 GCCTGTCGGGGGTGGGGGGCTGG - Intergenic
958731189 3:97962357-97962379 CCATGTGGGGGGGGGGGGGGGGG - Intronic
959215835 3:103448903-103448925 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
959223576 3:103553172-103553194 CTTTGTGGGGGGCGGGGTGGGGG + Intergenic
961363633 3:126384896-126384918 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
961658659 3:128456992-128457014 CCCTGGAGGGGGCTGGGGGAGGG - Intergenic
961705645 3:128783204-128783226 GTTTGTGGGGGGCGGGGGGGCGG - Intronic
962293649 3:134160004-134160026 GCGTGCAGGGGGCGGGGGGCAGG + Intronic
963868290 3:150386067-150386089 CCTTATATGGGGCTGGGGGGAGG + Intergenic
964132272 3:153302726-153302748 ACATGCGGGGGGCGGGGGGCGGG + Intergenic
964791938 3:160460696-160460718 TCTTGGAGGGGGCTGGGAGCAGG - Intronic
965091499 3:164169187-164169209 GCCTGTCGGGGGAGGGGGGCTGG - Intergenic
966215639 3:177499416-177499438 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
967921790 3:194619448-194619470 CCATGTAAGGGGCTGGAGGCAGG + Intronic
968024362 3:195426929-195426951 CCTTGGTGGGGGCGGGTGGCGGG - Intronic
969153352 4:5188856-5188878 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
969239315 4:5888622-5888644 GCGGGTGGGGGGCGGGGGGCGGG - Intronic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
969902672 4:10364237-10364259 CCTAGTATGGGGGGGGGGGGGGG - Intergenic
970776455 4:19680039-19680061 GCTTGTTGGGGGTGGGGGGAAGG - Intergenic
972178243 4:36434237-36434259 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
972662984 4:41134467-41134489 ATTTGTGGGGGGCTGGGGGCTGG - Intronic
972868623 4:43267916-43267938 TGTCGTAGGGGGTGGGGGGCTGG - Intergenic
972885927 4:43487793-43487815 CCTTTTAGGGGGTACGGGGCTGG - Intergenic
973773494 4:54226697-54226719 CCGTGTGGGGGGTGGGGGGAGGG - Intronic
973782561 4:54301932-54301954 CCTGTCAGGGGGTGGGGGGCCGG + Intergenic
973799813 4:54466100-54466122 GCTTGTTGGGGGTGGGGTGCTGG + Intergenic
974264375 4:59565456-59565478 CCTGTCATGGGGCGGGGGGCTGG - Intergenic
974827088 4:67144907-67144929 CCTGTTAGGGGGTGGGGGGAGGG + Intergenic
974854386 4:67441893-67441915 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
977154204 4:93552781-93552803 CCTATTGGGGGGTGGGGGGCTGG - Intronic
978329504 4:107597387-107597409 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
978713057 4:111808913-111808935 CATTGTGGGGGGAGGGGGGAAGG + Intergenic
979311103 4:119203976-119203998 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
981412249 4:144446162-144446184 CCTGTTAGGGGGTGGTGGGCTGG + Intergenic
981435168 4:144711487-144711509 CCTGTTGGGGGGCGGGGTGCAGG - Intronic
981923464 4:150112815-150112837 CTCTGTCCGGGGCGGGGGGCGGG - Intronic
981933812 4:150218085-150218107 CGTTGTGGGGGGAGGGGGGGCGG - Intronic
983688390 4:170437643-170437665 CCTATTGGGGGGTGGGGGGCTGG + Intergenic
983940472 4:173530407-173530429 ACTTGGCGGGGGGGGGGGGCAGG + Intergenic
984923411 4:184785594-184785616 CCTGGGCGGGGGCGGGGGGGGGG + Intronic
985164060 4:187074097-187074119 CCTTGCAGGAGGCAGGGGTCGGG + Intergenic
985233441 4:187846847-187846869 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
985277556 4:188252617-188252639 GCTTGTGGGGGGCGGGTGGAGGG + Intergenic
986584445 5:9300035-9300057 TTTTTTGGGGGGCGGGGGGCAGG + Intronic
986844968 5:11741562-11741584 CCTGTCAGGGGGCGTGGGGCTGG + Intronic
987279182 5:16395147-16395169 GCCTGTTGGGGGTGGGGGGCTGG - Intergenic
987327276 5:16823765-16823787 CCTGGCTGGGGGCGGGGGGCGGG + Intronic
987427005 5:17785002-17785024 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
987445998 5:18020673-18020695 CATGGGAGGGGGTGGGGGGCAGG + Intergenic
987853124 5:23382646-23382668 CCTTTCAGGGGGTGGGGGTCTGG + Intergenic
988055449 5:26088420-26088442 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
988469843 5:31527640-31527662 CCTGGTAAGGGGTGGGTGGCAGG - Intronic
988612284 5:32738285-32738307 CCTATCAGGGGGTGGGGGGCAGG - Intronic
988724698 5:33914849-33914871 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
988796584 5:34657233-34657255 CCTGGTGGGGGGTGGGGGGTGGG + Intronic
989138770 5:38181664-38181686 GCCTGTTGGGGGTGGGGGGCTGG + Intergenic
989328525 5:40228068-40228090 CCATGTAGGGGCCTGAGGGCTGG + Intergenic
989589925 5:43103993-43104015 TTTTGACGGGGGCGGGGGGCGGG + Intronic
990414777 5:55575595-55575617 ACTTGTACTGGGCGGGGGGGGGG - Intergenic
990990539 5:61679173-61679195 CCCTGTTGGTGGCGGAGGGCAGG - Intronic
992078868 5:73215988-73216010 CCTTAGATGGGGCGGGGGGGGGG + Intergenic
992346976 5:75889248-75889270 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
992517242 5:77506879-77506901 GCCTGTAGGGGGTGGGGAGCTGG + Intronic
993345038 5:86772466-86772488 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
994511877 5:100714362-100714384 CCTTTTAGAGGGCGGAGGGCAGG - Intergenic
994570944 5:101513141-101513163 CCTTGGGGGGGGGGGGGGGGGGG + Intergenic
994610060 5:102024644-102024666 CCTGTCAGGGGGCGGGGGCCAGG + Intergenic
994830971 5:104783611-104783633 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
996914749 5:128698922-128698944 CTTTATAGGAGGTGGGGGGCAGG - Intronic
997001538 5:129767764-129767786 TCTTGGCGGGGGCGGGGGGGGGG - Intergenic
997984534 5:138492169-138492191 CCTTGTATGGGCCTGGGGCCGGG - Intergenic
998003043 5:138639685-138639707 CCTGGTAGGGAGGGGGGAGCAGG - Intronic
998172997 5:139883322-139883344 GCAGGCAGGGGGCGGGGGGCGGG - Intronic
998206027 5:140157425-140157447 CCTGACAGGGGGCGGGGGGTGGG + Intergenic
998514686 5:142742251-142742273 GCTTGAAGGGGGCGGTGGTCAGG + Intergenic
999197318 5:149791193-149791215 AATTGTCTGGGGCGGGGGGCGGG + Intronic
999405384 5:151302565-151302587 GCTGGTTGGGGGTGGGGGGCAGG + Intronic
1001664450 5:173421062-173421084 CCAGGTGGGGGGCTGGGGGCTGG + Intergenic
1001777229 5:174337803-174337825 CATGGTAGGGGGCAGGGGGTTGG + Intergenic
1002069748 5:176672201-176672223 CCTTGGAGGGAGCAGGGGCCTGG + Intergenic
1002087952 5:176787528-176787550 CCATGGTGGGGGCGGGGGGGAGG + Intergenic
1002260785 5:177992748-177992770 CATGGGAGGGGGTGGGGGGCAGG + Exonic
1002319039 5:178364271-178364293 TCCTGTAAGGGGCGGGGGCCAGG - Intronic
1002665695 5:180822654-180822676 CCTTGTAGGGAGACTGGGGCAGG + Intergenic
1002710488 5:181192034-181192056 CCTTGGGCGGGGCGGGGGCCAGG + Intergenic
1002762370 6:211836-211858 CCTGTTAGTGGGCAGGGGGCTGG + Intergenic
1003206640 6:4018763-4018785 CCTTGGAGGGGGCGGGGCCCTGG - Intergenic
1003764557 6:9220447-9220469 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1004716690 6:18223337-18223359 GATTGGGGGGGGCGGGGGGCGGG - Exonic
1004942688 6:20577323-20577345 CCATGTAGGGGGCGGGGGTTAGG + Intronic
1005291137 6:24380033-24380055 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1005298658 6:24449993-24450015 GCTTTTGGGTGGCGGGGGGCGGG - Intronic
1005574360 6:27178155-27178177 TGTGGTGGGGGGCGGGGGGCAGG - Intergenic
1005622955 6:27636938-27636960 GCCTGTAGGGGGCGGGGGTGGGG - Intergenic
1006022544 6:31125989-31126011 GCTTGCAGGGGGTGGGGGGTGGG - Intronic
1006151969 6:31994533-31994555 CCTGGCTGGGGGCGGAGGGCTGG + Exonic
1006158271 6:32027271-32027293 CCTGGCTGGGGGCGGAGGGCTGG + Exonic
1006317314 6:33298481-33298503 CCTGGTCGTGGGCGGGGGGCAGG - Exonic
1006367066 6:33621946-33621968 CTTTGGAGGGGGCGGAGGGACGG + Intronic
1006376316 6:33673499-33673521 CTTTATGGGGGGCAGGGGGCAGG - Intronic
1006400165 6:33813090-33813112 CCTCTGGGGGGGCGGGGGGCGGG + Intergenic
1006459105 6:34148044-34148066 GCTGGTGGGGGGCGGGGGGTGGG - Intronic
1006514136 6:34536696-34536718 CCTTGTAGGAGGAGGGTGGGGGG - Intergenic
1007072924 6:39049528-39049550 GCTGGTAGGGGACGGGGGGTAGG - Intronic
1007393982 6:41566796-41566818 CCTTGAGTGGGGCAGGGGGCGGG + Intronic
1007982298 6:46171380-46171402 CAAGGCAGGGGGCGGGGGGCGGG - Intergenic
1008775828 6:55036536-55036558 CCTGTTAGGGGGAGGGAGGCTGG - Intergenic
1008812449 6:55520091-55520113 CCTGTCAGGGGGTGGGGGGCGGG + Intronic
1009184075 6:60552868-60552890 CCTTTTGGGGGGTGGGGGGCTGG + Intergenic
1009987610 6:70800664-70800686 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1010727569 6:79352766-79352788 CCTGTCAGGGTGCGGGGGGCTGG + Intergenic
1011378912 6:86721296-86721318 TCTGGTAGGGGGTGGGGGGACGG + Intergenic
1011615926 6:89198406-89198428 CGCTGCAGGGGGCGGGGGGCGGG + Intronic
1011633159 6:89346640-89346662 CACTGTAGGGGGTGGGGGGCAGG - Intronic
1012675998 6:102114436-102114458 CCTGGTAGGGGGTGGGGCGGAGG - Intergenic
1012873243 6:104696152-104696174 CCATGGTGGGGGCGGGGGGGGGG + Intergenic
1013004025 6:106053826-106053848 CATTGTGGGGGGTGGAGGGCTGG - Intergenic
1013693875 6:112677264-112677286 CCTTTTTGGGGGTGGGGGCCTGG + Intergenic
1013876473 6:114836686-114836708 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1014386167 6:120804972-120804994 CCTTGGAGGGGGTGGGGGAAGGG + Intergenic
1014951714 6:127563485-127563507 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1015706987 6:136098923-136098945 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1016995952 6:149962693-149962715 CCATGTACAGGGCTGGGGGCAGG - Intergenic
1017012230 6:150070477-150070499 CCATGTACAGGGCTGGGGGCAGG + Intergenic
1017729919 6:157306110-157306132 CCTTGTAGATGACGAGGGGCAGG + Intronic
1017877822 6:158538121-158538143 CAGAGTAGGGGGCGGGGGACGGG - Intronic
1018240307 6:161767754-161767776 CCTGGCTGGGGGTGGGGGGCTGG + Intronic
1018434571 6:163749010-163749032 CCTTGGTGGGGCAGGGGGGCTGG + Intergenic
1019342731 7:516208-516230 CCTTATCGGGGGCGGAGGGTGGG - Intronic
1019521923 7:1464761-1464783 CCTTGAAGGTGGGGGGGGGGGGG - Intergenic
1019611980 7:1941286-1941308 CCTGGCTGGGGGCTGGGGGCTGG - Intronic
1019714079 7:2530395-2530417 CCTTCTGGGGGGTGGGGGGGCGG - Intergenic
1020099880 7:5388794-5388816 CCTTGGGGGGCGCGGGCGGCGGG + Exonic
1021710141 7:23407934-23407956 ATTTGTGGGGGGCAGGGGGCGGG + Intronic
1021969611 7:25952678-25952700 CCGAGGAGGGGGTGGGGGGCTGG - Intergenic
1023290812 7:38667205-38667227 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1023382548 7:39623425-39623447 GCTTGCAGGGGGCGGAGGCCGGG + Intergenic
1023659496 7:42457916-42457938 CCTAGTAGAGGGCAGGGTGCTGG + Intergenic
1023881943 7:44325684-44325706 GCGTGCAGGGGGCGGCGGGCGGG - Intronic
1024591765 7:50892381-50892403 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1024601958 7:50990208-50990230 CCTGTTAGGGGCTGGGGGGCTGG - Intergenic
1025636637 7:63325708-63325730 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1025646059 7:63422394-63422416 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1025843525 7:65174561-65174583 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1025879520 7:65521406-65521428 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1025893918 7:65681182-65681204 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1026057545 7:66997631-66997653 CCATCTCGGGGGCGGGGGGGTGG - Intronic
1026800693 7:73397985-73398007 CCTTGTTGGGGGTGGGGGGCGGG + Intergenic
1027876355 7:83774256-83774278 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1027973784 7:85122079-85122101 GCCTGTTGGGGGCTGGGGGCTGG + Intronic
1028056593 7:86252705-86252727 CCTTGTGGGAGGCAGGGTGCTGG - Intergenic
1028086845 7:86645972-86645994 CTTTGTGGTGGGCGGGGGGGTGG + Intronic
1028368469 7:90063090-90063112 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1028683605 7:93567698-93567720 CCTGTTGGGGGGCAGGGGGCTGG - Intronic
1029370824 7:100149345-100149367 CCATGTAGGGGGGAGGGGGCCGG + Intronic
1030138801 7:106284827-106284849 CCTTGTAGGAGTCGGTGGCCAGG + Exonic
1030481774 7:110113619-110113641 CCTGGTGGGGGGGGGGGGGGTGG - Intergenic
1030521536 7:110603995-110604017 TCTTTTGGGGGGCGGGGGGGGGG - Intergenic
1030872888 7:114779392-114779414 CCTTGTAGGGGGTGGGAAGGAGG - Intergenic
1031178035 7:118377410-118377432 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1031406897 7:121396478-121396500 CCTGGCCGGGGGCGGTGGGCGGG - Intergenic
1031538810 7:122967612-122967634 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1031692913 7:124812942-124812964 CCTTGGAGCGGGTGGGGGGTGGG - Intergenic
1031705364 7:124974703-124974725 CCTGTTAGGGTGTGGGGGGCTGG - Intergenic
1031864733 7:127025999-127026021 CCTGTCAGGGGGCAGGGGGCTGG - Intronic
1032077780 7:128844245-128844267 CCTTGGAGGGATCAGGGGGCAGG - Exonic
1033595567 7:142855811-142855833 CCTTGTGGGGAGCAGGGGACAGG - Intronic
1033624673 7:143097209-143097231 CTTTGTGGGGGGTGGGGGGAAGG - Intergenic
1034120384 7:148621441-148621463 CCTCTTAGGAGGTGGGGGGCTGG - Intergenic
1035761514 8:2072231-2072253 CTTTTTTGGGGGCGGGGGGCGGG - Intronic
1036917493 8:12818548-12818570 TCTAGTTGGGGGTGGGGGGCGGG + Intergenic
1037422229 8:18715122-18715144 CCTTGTAGGGGGTGGGAAGACGG + Intronic
1037720215 8:21437333-21437355 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1037763149 8:21755631-21755653 CCTTGGTGGGGGCCGGGGGAGGG + Intronic
1037834536 8:22208388-22208410 CCTAGTATGGGGTGGGGGGCAGG - Intronic
1037994014 8:23339861-23339883 CCATGTGAGGGGCTGGGGGCTGG + Intronic
1038200746 8:25410465-25410487 CTTTTTAGGGGGGCGGGGGCAGG + Intronic
1038221187 8:25609518-25609540 CCTGTTGTGGGGCGGGGGGCAGG - Intergenic
1038425706 8:27462634-27462656 CCTTGGAGGTGGCGGCAGGCAGG - Intronic
1038572207 8:28672411-28672433 CCTTCTCGGGGTGGGGGGGCGGG + Intronic
1038582751 8:28764332-28764354 CCGGGGAGGGGGCGGGGGGATGG - Intergenic
1038872772 8:31514285-31514307 CCTGTTGGGGGGCTGGGGGCTGG - Intergenic
1039362402 8:36892488-36892510 CCTGGTGGGGGGTGGGGGGTGGG - Intronic
1039468272 8:37798431-37798453 CCTTGTAGGAGGCTTGGGGTCGG - Intronic
1039712389 8:40068877-40068899 CCTGTCAGGGGGTGGGGGGCAGG + Intergenic
1040038962 8:42897221-42897243 CCCGGTAGGTGGCGGGGGGAGGG - Intronic
1042591531 8:70402876-70402898 CCGTGGTGGGGGCGGGGAGCCGG - Intronic
1043603892 8:81975833-81975855 GCTTGTAGGGGGTGGGGGTCGGG - Intergenic
1043949553 8:86292377-86292399 CCTTTTTGGGGGAGGGGGGATGG - Intronic
1044291992 8:90483110-90483132 CCTTTTAGGGGATGGGGGGCTGG - Intergenic
1044763480 8:95547511-95547533 CCTGTTAGGGGGTGAGGGGCTGG + Intergenic
1044820766 8:96154309-96154331 GCTTGGAAGGGGCGGGCGGCGGG - Intronic
1045202282 8:99996104-99996126 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1045562921 8:103283313-103283335 CCTAGCAGTGGGCGGGGGGTGGG - Intergenic
1047584728 8:126258867-126258889 CCTGTTAGGGGGTGGGGGTCTGG - Intergenic
1047917626 8:129599712-129599734 GCCTGTTGGGGGTGGGGGGCTGG - Intergenic
1047998215 8:130357196-130357218 GCTGGTGGGGGGTGGGGGGCAGG - Intronic
1048510435 8:135056994-135057016 CCTTGTAGTGGGAGAGTGGCAGG + Intergenic
1048888909 8:138931081-138931103 CCTTGGGAGGGGCGGGGAGCAGG - Intergenic
1049368265 8:142251324-142251346 TTTTGTGGGGGGAGGGGGGCGGG - Intronic
1049502480 8:142974818-142974840 CTGTGCGGGGGGCGGGGGGCGGG - Intergenic
1049567609 8:143349308-143349330 ACTTGCAGGGGGCAGGGGGGTGG - Intronic
1049612523 8:143562118-143562140 CCTTGGAGGAGGCGGTGAGCGGG + Exonic
1049811222 8:144573449-144573471 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1050071552 9:1820287-1820309 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1050477228 9:6052921-6052943 TTTTGTGGGGGGGGGGGGGCGGG - Intergenic
1050597845 9:7221968-7221990 CCTTTTGGGGGGTGGGGGGCTGG + Intergenic
1051179035 9:14391339-14391361 CCTGGAAGCGGGCGGGGGGTGGG - Intronic
1051254723 9:15201745-15201767 ACCTGTAAGGTGCGGGGGGCGGG + Intronic
1051294634 9:15582775-15582797 CCTGGCAGGAGGTGGGGGGCTGG + Intronic
1051302821 9:15671506-15671528 CCTGGCAGGGGGTGGGGGGCTGG - Intronic
1051305058 9:15700131-15700153 CCATGGAGGGGGTGGGAGGCAGG + Intronic
1051481827 9:17569977-17569999 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1051548244 9:18300454-18300476 CCTGTCAGGGGGAGGGGGGCTGG + Intergenic
1051985930 9:23086923-23086945 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1052185753 9:25591627-25591649 CCTTTTGCGGGGCGGGGGGCTGG + Intergenic
1052217852 9:25988568-25988590 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1052374713 9:27706028-27706050 TTTTGTTGGGGGTGGGGGGCAGG + Intergenic
1053140063 9:35676548-35676570 CCTTGTTGGGGGCTGGTGCCTGG - Intronic
1053530160 9:38873143-38873165 CCTGGTGGGGGGCGGAGGGGGGG + Intergenic
1054635973 9:67490790-67490812 CCTGGTGGGGGGCGGAGGGGGGG - Intergenic
1054890541 9:70246309-70246331 CCTGCCAGGGGGTGGGGGGCTGG + Intergenic
1055296030 9:74834606-74834628 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1057023674 9:91719742-91719764 ACTTGTAGGGGGAGGGTGGAGGG + Intronic
1057605459 9:96495398-96495420 CCTGGGCAGGGGCGGGGGGCGGG - Intronic
1058437300 9:104974864-104974886 CTATGTCGGGGGCTGGGGGCGGG + Intergenic
1060630834 9:125157120-125157142 ACTGGTAGGGGGAGGGGGGAGGG - Intronic
1061310118 9:129756534-129756556 CCTTGCAGAGGGTGGGGGACAGG + Intergenic
1062361974 9:136192709-136192731 CCTTGCAGCGGGGGCGGGGCTGG - Intergenic
1062462063 9:136666202-136666224 GCTGGGAGGGGGCGGCGGGCAGG + Intronic
1062482596 9:136759417-136759439 CCTGGGAAGGGGCAGGGGGCAGG - Intergenic
1062517103 9:136942244-136942266 CCTTGGCGTGGGCGGGGGCCGGG + Exonic
1185456718 X:314404-314426 CCTAGTGGGGAGCCGGGGGCAGG + Intronic
1186392329 X:9173417-9173439 CAGTGTCGGGGGCGGGGGGGGGG + Intergenic
1186448761 X:9654699-9654721 CCATTTAGGGGGCGGGGAGTAGG - Intronic
1186539904 X:10389716-10389738 CCTTGTGGGGGGGGGGGGGGTGG + Intergenic
1186586039 X:10874035-10874057 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1186867044 X:13730910-13730932 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1188129436 X:26413145-26413167 CTTTTTTGGGGGGGGGGGGCAGG + Intergenic
1188463891 X:30456419-30456441 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1188950712 X:36370248-36370270 CCTGCTGGGGGGTGGGGGGCTGG - Intronic
1189501828 X:41568082-41568104 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1190334328 X:49253255-49253277 CCTTGTAGGGGGAGGGGACAGGG - Intronic
1190475219 X:50820498-50820520 AGTTGGCGGGGGCGGGGGGCGGG - Intergenic
1190957260 X:55207922-55207944 CAGGGCAGGGGGCGGGGGGCGGG + Intronic
1192082715 X:68063857-68063879 CCTTGTGGTGGGCCAGGGGCCGG + Exonic
1192558171 X:72106956-72106978 GCTTGTCGGGGGGTGGGGGCTGG + Intergenic
1192678082 X:73221371-73221393 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1192788634 X:74358009-74358031 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1193437615 X:81496486-81496508 CTTTGTTGGGGGCAGGGGGAGGG + Intergenic
1194052627 X:89090680-89090702 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1194056927 X:89146426-89146448 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1194223515 X:91226742-91226764 CCGTGCTGGGGGCAGGGGGCTGG + Intergenic
1194434755 X:93856208-93856230 CCTGGGAGGGGCCGGTGGGCAGG + Intergenic
1194459748 X:94151733-94151755 CCTGTCATGGGGCGGGGGGCAGG - Intergenic
1194880236 X:99242073-99242095 CCTTGATGGGGGCGGGGGGCAGG - Intergenic
1194989760 X:100534513-100534535 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1194990013 X:100537275-100537297 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1195013065 X:100752310-100752332 CCTGTTGGGGGGTGGGGGGCAGG - Intergenic
1195132876 X:101871867-101871889 CCTTTTGGGGGGTGGGGGGTGGG - Intergenic
1195702639 X:107716548-107716570 CCTGGGAAGGGGCGGGGGGGAGG - Intronic
1195753370 X:108178442-108178464 CCATGGAGGAGGCGGGGGGAGGG + Intronic
1196115312 X:111993049-111993071 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1196854525 X:119970373-119970395 CCGGGGGGGGGGCGGGGGGCGGG + Intergenic
1197169413 X:123414570-123414592 GCCTGTCGGGGGTGGGGGGCTGG - Intronic
1197703560 X:129617516-129617538 CCTTTAAGATGGCGGGGGGCGGG + Intergenic
1199017058 X:142830453-142830475 TGTTGTGGGGGGCGGGGGGGCGG - Intergenic
1199496552 X:148458774-148458796 CATTGTAGGGGGTGGGCGGGGGG - Intergenic
1199529036 X:148826223-148826245 GCTTGCAAGGGGCGGGGGGTGGG + Intronic
1199645525 X:149906578-149906600 CCTTTTGGGGGGTAGGGGGCTGG + Intergenic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1199976857 X:152899257-152899279 CCTGGCTGGGGGCGGGAGGCAGG + Intergenic
1200012920 X:153133670-153133692 CTGTGTCGGGGGCGGGGGGGAGG - Intergenic
1200026681 X:153266253-153266275 CTGTGTCGGGGGCGGGGGGGAGG + Intergenic
1200268079 X:154656955-154656977 GCCTGTTGGGGGTGGGGGGCTGG + Intergenic
1200370845 X:155722930-155722952 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1200420184 Y:2956686-2956708 CCATCTTGGGGGCGGGGGGGGGG - Intronic
1200559982 Y:4690124-4690146 CCGTGCTGGGGGCAGGGGGCTGG + Intergenic