ID: 1183831646

View in Genome Browser
Species Human (GRCh38)
Location 22:40421243-40421265
Sequence TCTGCTTTTCACGGGGTGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183831646_1183831653 6 Left 1183831646 22:40421243-40421265 CCGTACACCCCGTGAAAAGCAGA 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1183831653 22:40421272-40421294 CCCAGAAATGTGCCAGGAAAGGG 0: 1
1: 0
2: 0
3: 29
4: 311
1183831646_1183831650 0 Left 1183831646 22:40421243-40421265 CCGTACACCCCGTGAAAAGCAGA 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1183831650 22:40421266-40421288 AATGTGCCCAGAAATGTGCCAGG 0: 1
1: 1
2: 2
3: 42
4: 432
1183831646_1183831655 7 Left 1183831646 22:40421243-40421265 CCGTACACCCCGTGAAAAGCAGA 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1183831655 22:40421273-40421295 CCAGAAATGTGCCAGGAAAGGGG 0: 1
1: 0
2: 3
3: 31
4: 325
1183831646_1183831659 25 Left 1183831646 22:40421243-40421265 CCGTACACCCCGTGAAAAGCAGA 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1183831659 22:40421291-40421313 AGGGGCTGGAGTGACAAAGAGGG 0: 1
1: 0
2: 3
3: 43
4: 427
1183831646_1183831656 11 Left 1183831646 22:40421243-40421265 CCGTACACCCCGTGAAAAGCAGA 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1183831656 22:40421277-40421299 AAATGTGCCAGGAAAGGGGCTGG 0: 1
1: 0
2: 4
3: 47
4: 542
1183831646_1183831658 24 Left 1183831646 22:40421243-40421265 CCGTACACCCCGTGAAAAGCAGA 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1183831658 22:40421290-40421312 AAGGGGCTGGAGTGACAAAGAGG 0: 1
1: 0
2: 3
3: 29
4: 383
1183831646_1183831651 5 Left 1183831646 22:40421243-40421265 CCGTACACCCCGTGAAAAGCAGA 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1183831651 22:40421271-40421293 GCCCAGAAATGTGCCAGGAAAGG 0: 1
1: 0
2: 0
3: 27
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183831646 Original CRISPR TCTGCTTTTCACGGGGTGTA CGG (reversed) Intronic
907337872 1:53712251-53712273 TCTGATTTTCACAGGGTCTCTGG - Intronic
907438479 1:54464167-54464189 TCTGCTGTTCCCTGGGTGAATGG - Intergenic
911946708 1:104118981-104119003 TCTGCGTTGCACTGGGTGTCAGG - Intergenic
913579704 1:120213966-120213988 TCTTCTTTTCACATTGTGTACGG - Intergenic
913628470 1:120684422-120684444 TCTTCTTTTCACATTGTGTACGG + Intergenic
914561638 1:148825393-148825415 TCTTCTTTTCACATTGTGTACGG - Intronic
914611194 1:149304815-149304837 TCTTCTTTTCACATTGTGTACGG + Intergenic
915571001 1:156744968-156744990 TCTGCTTTCCAGGGGGTCTCTGG + Intronic
916013991 1:160732252-160732274 TCTGCTTTTCTGGGGGTGGGGGG - Intergenic
919930501 1:202218252-202218274 CCTGCTATTCAGGGGGTGTTTGG + Intronic
921609183 1:217190730-217190752 TCTGCTTTTTAAGGGGTTTTAGG + Intergenic
1063768811 10:9174549-9174571 TCTGCATTTCACTGGCTGTGTGG + Intergenic
1064411164 10:15105530-15105552 TCTGCTGTTTACAGTGTGTATGG + Intronic
1064706379 10:18076642-18076664 TCTGATTTTCAAAGGGTGTCAGG + Intergenic
1065171293 10:23033011-23033033 TTTGCTTTTCAAGGTGTGTAAGG + Exonic
1066311962 10:34206026-34206048 TCTGCTTTTCTCTGGCTGTATGG - Intronic
1066312086 10:34206918-34206940 ACTGCTTTTCTCTGGCTGTATGG - Intronic
1066638512 10:37532185-37532207 TTTGTTTTTCTCTGGGTGTAGGG + Intergenic
1067285210 10:44902951-44902973 TGTGCTCTTCAAGGGGTGTAGGG - Intergenic
1072307298 10:94120050-94120072 CCTGCCTTTCTCTGGGTGTAGGG + Intronic
1078151477 11:8762941-8762963 TTTGCTTTTCACTGTCTGTATGG - Intronic
1078655799 11:13238018-13238040 TCTGGCTTTCACTGGGTGAATGG - Intergenic
1079302696 11:19293067-19293089 CCTGCTTTTCATTTGGTGTATGG + Intergenic
1079425444 11:20337743-20337765 TGTGCTTTCCACGGAGTTTACGG + Intergenic
1083109075 11:60387306-60387328 TCTGCTTTGCCTGGGGAGTAAGG - Intronic
1084551452 11:69845540-69845562 TCTGCTTTTGATGGGGAGTGGGG + Intergenic
1085088540 11:73690017-73690039 ACTTCTTTTCACATGGTGTAAGG + Intronic
1088550069 11:111003883-111003905 TCTGCTTATCCCAGGGTGGAGGG + Intergenic
1089565475 11:119368986-119369008 TCTCCTGTTCCCGGGGTCTATGG - Intronic
1090920495 11:131202260-131202282 TTTGCTGTTCACTGTGTGTAAGG - Intergenic
1093675388 12:21933213-21933235 TTTGCTTTTCAGAGGGTGGAGGG + Intronic
1097959063 12:65514737-65514759 GCTGCTTCTCACAGGGGGTATGG - Intergenic
1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG + Intronic
1108345797 13:49545973-49545995 TCTGCATTGCATGGGGTGGAGGG - Intronic
1109374691 13:61476599-61476621 TTTGCTTTTTACTGGGAGTAGGG - Intergenic
1112267879 13:97942060-97942082 TCTGCTCTTCTAGGCGTGTAGGG - Intergenic
1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG + Intronic
1115091026 14:29575698-29575720 TCTGCTTTTCTCTAGGGGTAGGG - Intergenic
1120761209 14:88287199-88287221 ATTGTTTTTCACAGGGTGTAAGG - Intronic
1126171136 15:45696300-45696322 TCTGCTTCTCATTGAGTGTATGG + Intergenic
1127572788 15:60260647-60260669 TTTGCCTTTCACTTGGTGTATGG + Intergenic
1127861937 15:63001016-63001038 TCTGCTGGTCACTGGCTGTAGGG + Intergenic
1128150436 15:65360136-65360158 TTTGCTTTTTGCGGGGTGGAGGG - Intronic
1128460255 15:67861597-67861619 TCTGCTTTTCACAGGGGATAGGG - Intergenic
1129186942 15:73913840-73913862 TCTACTTTTCACGGGGAAAAAGG + Intergenic
1130543103 15:84836086-84836108 GCTGCTTTACACGGGGTGGAAGG + Intronic
1133402966 16:5502265-5502287 TCTCCATTTCATGGGGTGAAAGG - Intergenic
1135392396 16:22104858-22104880 TCTGCTTTTCCCAGGGTTTAAGG - Intronic
1144624804 17:16839188-16839210 TCTGGTTGTGGCGGGGTGTATGG + Intergenic
1144881626 17:18433533-18433555 TCTGGTTGTGGCGGGGTGTATGG - Intergenic
1145150607 17:20510853-20510875 TCTGGTTGTGGCGGGGTGTATGG + Intergenic
1146956223 17:36937696-36937718 TCTGCTTTTGTCGGGGTATGAGG - Exonic
1151544314 17:74783255-74783277 TCTGCATTTCTCAGGGTGTCTGG - Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1156858230 18:41807855-41807877 TCTGCTTCTCACTAGCTGTATGG - Intergenic
1160060800 18:75527203-75527225 CCTCCTTTTCAGGGGGTGCAGGG - Intergenic
1161517610 19:4705030-4705052 ACTGCTTTCCACAGAGTGTAGGG - Intronic
1166395813 19:42440296-42440318 TATGCTTTTCACAGGGTTAAGGG - Intronic
926477879 2:13350287-13350309 TGTGATTTTCACTGGGTGTTTGG - Intergenic
927097649 2:19759764-19759786 TCTCCTTTTGATGGGGTATATGG - Intergenic
927391118 2:22596583-22596605 TTTGCTTTTCACTGGGGGAATGG + Intergenic
932139454 2:69262744-69262766 ACTGCTTTTCATGGGGCGTATGG - Intergenic
935701492 2:105815990-105816012 CCTGCTGTTCACCGGGTGTGTGG + Intronic
939490859 2:142874509-142874531 TCTTCTTTACACAGGGTGTTGGG - Intergenic
939896820 2:147801508-147801530 TCTGCTTATCAGTGTGTGTAAGG + Intergenic
942606441 2:177696578-177696600 TCTGCTCTTCACGGTGTAAATGG + Intronic
946320679 2:218952571-218952593 TCTGCTTTTCAAGGGCTTTGAGG - Intergenic
946476031 2:220007257-220007279 TCTGCTAATCACTGGCTGTAAGG + Intergenic
1169559809 20:6787608-6787630 TCTCCTTTTCTCCGGGTGTCAGG + Intergenic
1175341928 20:58237580-58237602 TGTGCCTTTCACGGTGTGGAGGG - Intergenic
1183831646 22:40421243-40421265 TCTGCTTTTCACGGGGTGTACGG - Intronic
950484487 3:13265033-13265055 TCTGCTTTCCAGGGGGAGAAGGG - Intergenic
962562589 3:136622628-136622650 TCTGCTTGTCAAGGGGTTAAGGG - Intronic
963880368 3:150521691-150521713 TCTGCTTTTCACTGATTTTATGG - Intergenic
965634984 3:170771620-170771642 TCTGCTATACACTTGGTGTAGGG - Intronic
965909327 3:173752365-173752387 TCTGCTTATGACGAGGTGTAAGG - Intronic
980043692 4:127965823-127965845 TCTACCTTTCACGGGGGGAAGGG - Intronic
983116655 4:163825937-163825959 TCTGCTCTGCACTGGGTGTAGGG - Intronic
986705978 5:10455342-10455364 TCTTCTTCTCACGGGCTGCAGGG - Intronic
994002007 5:94791847-94791869 TCTTCTTTTCCCAGGGTGAAAGG + Intronic
995661757 5:114491846-114491868 TGTTCTTTTTAGGGGGTGTAGGG + Intronic
999873958 5:155781884-155781906 TCTGCATTTCATGGGATGAAAGG - Intergenic
1001818061 5:174688111-174688133 TCTGCTGTTTACTGGGTATACGG - Intergenic
1011774002 6:90707800-90707822 TCAGCATTTCAGGGGGTGAAAGG - Intergenic
1016799299 6:148152780-148152802 TCTGCTTTTCATGGGGAGGCTGG + Intergenic
1018964842 6:168476347-168476369 TCTGTTTTTCACTGGGTGTTTGG + Intronic
1019640019 7:2098387-2098409 TCTGGTTGTCACAGGGTTTAGGG - Intronic
1021083619 7:16392826-16392848 TCTGCTTTTCACTGTTTGTTGGG - Intronic
1027178022 7:75916916-75916938 TCTGATTTTCAAGGGGTTAAGGG - Intronic
1032386655 7:131530057-131530079 TCTTCTTTCCAGGGGGTGCAGGG + Intronic
1034974437 7:155439651-155439673 TTAGCTTTTCTCGGGGTTTACGG - Intergenic
1040913023 8:52540795-52540817 TCTGCTTCTCGTGGGGTCTACGG + Intronic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1046607620 8:116388897-116388919 TCTGCTTTTCAGATGATGTATGG + Intergenic
1055758726 9:79583434-79583456 TCTGCGTTTCACGGAATGAAAGG + Intronic
1057956935 9:99417601-99417623 CCTGCTTTTCCCGAGCTGTATGG + Intergenic
1060451694 9:123748674-123748696 TTTGCTTTTCACTGGGTGGGAGG - Intronic
1061668306 9:132173402-132173424 CCTGCCTTCCACGGGGTGTCTGG - Intronic
1192809876 X:74538081-74538103 TCTGCCTTTCTCTGGGAGTATGG + Intergenic
1194048639 X:89039426-89039448 TCTGCCTTTCAGAGGATGTATGG + Intergenic
1197133160 X:123029553-123029575 TCTGCTGTTCACAAGGAGTAAGG + Intergenic