ID: 1183832977

View in Genome Browser
Species Human (GRCh38)
Location 22:40428827-40428849
Sequence CCTGATGAGAAGGCACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183832977_1183832984 2 Left 1183832977 22:40428827-40428849 CCTTCCAGTGCCTTCTCATCAGG 0: 1
1: 0
2: 0
3: 30
4: 270
Right 1183832984 22:40428852-40428874 CTAGGGTTGTTCTCCCTGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183832977 Original CRISPR CCTGATGAGAAGGCACTGGA AGG (reversed) Intronic
901056168 1:6449455-6449477 TCTGATGAGCTGGTACTGGAGGG + Intronic
901484481 1:9549119-9549141 CAGGATGAGAAGGGACTGGGTGG + Intronic
901514581 1:9736389-9736411 CCAGCTGAGAAGGCAGTGGCTGG - Intronic
902478191 1:16699039-16699061 TCTGATGAGCTGGTACTGGAGGG - Intergenic
903364026 1:22794866-22794888 CCAGATGAAAAGGCAGTGGCTGG - Intronic
903687607 1:25143382-25143404 TCTGAGGAGGAGGCACTGGCAGG - Intergenic
903896173 1:26606631-26606653 TGAGATGAGAAGCCACTGGAGGG + Intergenic
905533974 1:38704337-38704359 TGTGATCAGAAGCCACTGGAGGG + Intergenic
907070036 1:51526229-51526251 CTTGATGAGAAGTCCCTGTAGGG - Intergenic
907386925 1:54131992-54132014 GCTGAAGTGAGGGCACTGGATGG + Intergenic
907550488 1:55300866-55300888 CCTGATGGGAAGTAGCTGGATGG - Intergenic
907553166 1:55321461-55321483 CCTCCAGAGAAGGCACAGGATGG + Intergenic
907769324 1:57444149-57444171 CCTGGGGAGAAGCCATTGGAGGG - Intronic
907908295 1:58805040-58805062 GGTGATGAGAAGCCACCGGAGGG - Intergenic
910614896 1:89186688-89186710 TGTGATGCGAAGGCACTGGCTGG + Intronic
910767321 1:90794714-90794736 CATGATGAGAATTCACTGGGTGG + Intergenic
911104542 1:94119502-94119524 CCTGAGGAGAAAGCCCTGGCAGG - Intronic
912414687 1:109499908-109499930 CCAGACGAGAAGTCACTGCAAGG - Intronic
912698543 1:111859207-111859229 CCTGCTGGGAAGCCACTGGCTGG + Intronic
914834949 1:151199060-151199082 CCTGAGGACAAGGTACAGGAAGG - Exonic
915291115 1:154883990-154884012 CCTGGACAGAAGGCACTGCATGG + Intergenic
916652641 1:166845695-166845717 AGTGATAAGAAGGCACTGGATGG - Intronic
917626021 1:176847117-176847139 CATGAGGAGAGGGCCCTGGAAGG - Intergenic
918730027 1:187981550-187981572 CGTAATGAGAAGACACTGGGGGG - Intergenic
919071474 1:192761373-192761395 CATGATGGGAAACCACTGGAGGG + Intergenic
920251859 1:204627338-204627360 CATGGTGGGAAGGGACTGGAGGG + Intronic
922423685 1:225475483-225475505 GCTGATGAGAAGACACTGCTGGG - Intergenic
922672305 1:227520014-227520036 TATAATGAGAAGGCACTGAAAGG + Intergenic
923447890 1:234089494-234089516 ACTGATGTGAAGACACTGCAGGG - Intronic
923462808 1:234221696-234221718 GCTCAGGAGAAGGGACTGGAGGG + Intronic
923682517 1:236129477-236129499 CCAGATGAGAAGACACAGGATGG + Intergenic
924822262 1:247504654-247504676 TATAATGAGAAGGCACTGAAAGG + Intergenic
924941044 1:248812618-248812640 CCTGAGAGGAAGGCTCTGGAAGG - Intronic
1063408665 10:5819672-5819694 GTTGAAGAGAAGGGACTGGAAGG - Intronic
1065095869 10:22280171-22280193 CCAGATGGGAATACACTGGAAGG - Intergenic
1065690663 10:28330214-28330236 AATGATTTGAAGGCACTGGAGGG + Intronic
1066311050 10:34197035-34197057 GCAGATGGGAAGGCACAGGATGG - Intronic
1067658017 10:48211872-48211894 CCCCTTGAGAAGGCTCTGGAGGG + Intronic
1068393649 10:56432214-56432236 CCTGATGCAGAAGCACTGGATGG - Intergenic
1069179976 10:65346688-65346710 CCTGAAGACAAGGAACTGGTCGG - Intergenic
1069761480 10:70814651-70814673 CTTGATGAGTAGGCATTGGCAGG + Intergenic
1070582085 10:77728909-77728931 CCTGCTGGGAAGGCCCAGGAAGG + Intergenic
1070679970 10:78442080-78442102 CCCCAGGAGAAGACACTGGATGG + Intergenic
1072423655 10:95310788-95310810 CGAGATGAGAAGCCACTAGAGGG + Intergenic
1074224236 10:111467978-111468000 TCTGAGAAGAAGGCACTGGCTGG - Intergenic
1074793792 10:116920381-116920403 AATGATGAGATGGGACTGGAAGG - Intronic
1074973125 10:118558256-118558278 ACAGATGTGAAGGCCCTGGAGGG - Intergenic
1076726395 10:132416148-132416170 CCCGCCGAGAAGTCACTGGAGGG - Intronic
1079026016 11:16948480-16948502 CCTGATGTGAGGGAAATGGAGGG - Intronic
1081776473 11:45679067-45679089 CCTGAAGAGAAGGGGCTGGCGGG - Intergenic
1081829639 11:46097252-46097274 TATGATGGGAAGCCACTGGAGGG - Intronic
1082980529 11:59116588-59116610 ACTGAGGAGAAGGCAGTTGAGGG + Intronic
1083310236 11:61780159-61780181 CCTAGAGAGAGGGCACTGGATGG + Intronic
1084951318 11:72667460-72667482 CCTGCTGAAATGGCACTGGGAGG - Intronic
1085447642 11:76611191-76611213 CCCCATGAGAAGGAACTGGACGG - Intergenic
1085730910 11:78997801-78997823 CATGATGTGATGGCATTGGAAGG + Intronic
1087849600 11:103012786-103012808 CCTGATGAGAACAAACTGGAAGG + Intergenic
1088321283 11:108556841-108556863 CATGATGAGAAGCTGCTGGAGGG - Intronic
1088381677 11:109200146-109200168 CCTGATGTAAAGGCCCTGGATGG + Intergenic
1088436119 11:109814985-109815007 TCTGATGGGAAGCCATTGGAAGG + Intergenic
1088945762 11:114511231-114511253 CATGATCAGAAGTCACTGGGTGG + Intergenic
1091534675 12:1394552-1394574 CCTGATGAGAGGTGATTGGATGG + Intronic
1092218456 12:6697952-6697974 CAGGATGGGAAGGCTCTGGATGG + Intronic
1092223378 12:6730602-6730624 CCAGATGAGCAGGGGCTGGAAGG + Intronic
1092560154 12:9604300-9604322 CCTGATGAAAAGCCATTGGAAGG - Intronic
1092773691 12:11922301-11922323 CATCAAGAGCAGGCACTGGAGGG + Intergenic
1095969434 12:47891731-47891753 CTGGATGAGAAGGGACAGGAAGG - Intronic
1096649973 12:53057742-53057764 GCAGAGGAGAAGGCACAGGAGGG - Intronic
1098501839 12:71202090-71202112 CTTTATGAGAAGGAAGTGGATGG + Intronic
1099500313 12:83405773-83405795 CCAGATGAGAACTCCCTGGATGG + Intergenic
1100289676 12:93201891-93201913 CATGATGGGAAGCCACGGGAAGG - Intergenic
1100492001 12:95089627-95089649 ACTGATGATAAGGCACTTGAAGG + Exonic
1102502049 12:113359373-113359395 CCTGCTGACCTGGCACTGGAAGG - Intronic
1102818871 12:115891120-115891142 TGTGATGGGAAGTCACTGGAAGG - Intergenic
1104013914 12:124950059-124950081 CCTGATGAGAGACCACAGGAAGG + Exonic
1104439768 12:128785266-128785288 CCTTATGAGAAGGGATAGGAAGG + Intergenic
1104971241 12:132531759-132531781 CCTAATGAGAAGGCACAGCCAGG + Intronic
1106100840 13:26694376-26694398 TCAGCTGAGAAGGCACTGAAGGG - Intergenic
1106483339 13:30153264-30153286 TCTGGGGAGAAGACACTGGAAGG + Intergenic
1107528057 13:41253461-41253483 TCTGCTGAGAAGGCACAGCATGG - Intronic
1108597961 13:51965809-51965831 CCTGATGCGAAGTCACTGAGGGG + Intronic
1114267347 14:21080779-21080801 CCAGGTGAGAAGGGGCTGGAGGG + Exonic
1115085524 14:29510798-29510820 CCTAATGGGGAGGCATTGGATGG - Intergenic
1120474948 14:84975026-84975048 CCTGATCAGAAGGCAAAGCATGG + Intergenic
1120860158 14:89247776-89247798 TGTGATGGGAAGCCACTGGAAGG - Intronic
1121119388 14:91366657-91366679 CCTGATGAGAAGATGCTTGAAGG - Intronic
1121852698 14:97236691-97236713 CCTCACGAGAAGGCACCAGAAGG - Intergenic
1122124531 14:99571953-99571975 CCTCAGGGGAAGGAACTGGAGGG + Intronic
1122543678 14:102510886-102510908 CCTGGTGAGATAGTACTGGAAGG - Intergenic
1122941397 14:104983003-104983025 CCTGATGAGCAAGGACTGGCTGG - Intergenic
1122997507 14:105273330-105273352 CCTGCTGAGAAGGGACGGGTGGG - Intronic
1123976399 15:25558347-25558369 CCTGATGGAAAGGCAGTGGTGGG + Intergenic
1125040675 15:35183288-35183310 CCTGCTGAGAAGGAAATGTAGGG - Intergenic
1125541027 15:40470392-40470414 CATGAGGAGAAGGCAGAGGAGGG + Intergenic
1125788980 15:42348591-42348613 CCTGATAAGAAATCACTGGTTGG - Intronic
1126538999 15:49801639-49801661 CCTGAAGGGAAGCCAGTGGAGGG - Intergenic
1128105743 15:65043448-65043470 AGTGATGAGAAGCCACTGGAGGG - Intergenic
1128868826 15:71136804-71136826 CCTGAGGAGAAGGGGCAGGAAGG + Intronic
1128982171 15:72196203-72196225 CCTGATCAGAAGACTATGGAGGG + Intronic
1129557682 15:76529865-76529887 TATGATGAGGAGTCACTGGAGGG + Intronic
1129795406 15:78372707-78372729 CTTGTGGAGAAGGGACTGGATGG + Intergenic
1130174089 15:81549286-81549308 ACTCATGGGAAGGCACTAGAGGG + Intergenic
1130892899 15:88148686-88148708 AGTGGTGGGAAGGCACTGGATGG + Intronic
1132550446 16:551859-551881 CCTGAAGAGCCGGCCCTGGAGGG + Intronic
1132568842 16:635340-635362 CCTGGTGAGTAGGAACAGGACGG + Exonic
1132819263 16:1854875-1854897 CCACATGAGAAGCCACTGGGTGG - Intronic
1132892145 16:2209706-2209728 CCTGTTGAGAAGGCTCTGGTGGG + Exonic
1132987048 16:2772757-2772779 CATGATGGGAAGCCACTGGATGG - Intronic
1133017593 16:2951442-2951464 CCAGAAGAGCTGGCACTGGAGGG - Intergenic
1133202102 16:4209977-4209999 CCTGAAGAGAAGGCACGTGCAGG - Intronic
1134746896 16:16595478-16595500 GCTGATGAGCAGCCACAGGATGG + Intergenic
1134998578 16:18758185-18758207 GCTGATGAGCAGCCACAGGATGG - Intergenic
1141168129 16:81674154-81674176 CCTGATCAGAAGGAAGTGCAGGG + Intronic
1141269810 16:82528899-82528921 TCTGGTGTGAAGGCACTGGAAGG - Intergenic
1141917911 16:87112853-87112875 TCTGATGAGTGGGCACAGGAAGG - Intronic
1141967697 16:87458139-87458161 CCTGAAGAAAAAGCACTGAAGGG + Intronic
1143374870 17:6461556-6461578 CCTGGTGAGATGGCATTAGAAGG + Exonic
1144097596 17:11915726-11915748 CAGGATGAGTAGGCATTGGATGG - Intronic
1146159353 17:30551630-30551652 CCTAAGGAGAAGGCACTTCAGGG - Intergenic
1146547929 17:33755116-33755138 CCTTATGAGAGGGCAGAGGAAGG + Intronic
1146890356 17:36502616-36502638 GCAGATGAGCAGGCACTGCAGGG - Intronic
1148895275 17:50835861-50835883 CCTGAGAAGAAGGCCCTGGTGGG + Exonic
1150227339 17:63531172-63531194 CCTCATGAGAAGGGACAGCAGGG - Intronic
1150515951 17:65809320-65809342 ACTGATGAGAAGCCATTGGAGGG + Intronic
1150815141 17:68386780-68386802 TCTGATGAGAAGCCACTGGTTGG - Intronic
1151037293 17:70815868-70815890 GCTGAGGAGAAGGCATTGAAAGG - Intergenic
1152526491 17:80890875-80890897 CTGGATGAGCAGGCTCTGGATGG - Intronic
1152809934 17:82376511-82376533 ACTGAGGGGTAGGCACTGGAGGG - Intergenic
1155545762 18:26913011-26913033 CCACATGAGAATGCACAGGAGGG + Exonic
1156405735 18:36781131-36781153 TCAGATGGGAAGGCACTGGGAGG + Intronic
1157981661 18:52388702-52388724 GCAGAAGAGAAGGCCCTGGAAGG - Intronic
1158564555 18:58543630-58543652 TCTCAGCAGAAGGCACTGGAAGG - Intronic
1158700100 18:59737742-59737764 ACTGGTGAGAAGCCCCTGGAAGG + Intergenic
1159330717 18:66991127-66991149 CCTGTTGAGAAGGCACAGCATGG - Intergenic
1160735315 19:659613-659635 CCTGCTGAGGAGGCACTGACTGG - Intronic
1161002550 19:1918085-1918107 ACGGATGAGCAGGCACGGGAGGG - Intronic
1161127986 19:2570666-2570688 CATGAACAGAAGGTACTGGAAGG + Intronic
1161597462 19:5157910-5157932 CCGGAGGCGAAGGCTCTGGAGGG + Intergenic
1162187458 19:8917022-8917044 CCTGATGTGAGGGCACTGATAGG - Intronic
1163611957 19:18306297-18306319 CCTGAAGAGAAGGCTATGCAGGG + Exonic
1166326991 19:42057076-42057098 CCTGGTGAGAAGACACTCCATGG + Intronic
1166665330 19:44676386-44676408 CCTGGTGACAAGGAACTGGAGGG + Exonic
1166713467 19:44951659-44951681 CCTGAGGAGAAGGGACTGGGGGG - Intronic
1167158885 19:47755190-47755212 GCTGCTGGGAAGGCACTGGAGGG + Intronic
1167533955 19:50037229-50037251 CCTGATGAGATGGGACTCGTTGG + Intronic
1167784715 19:51627623-51627645 CTTGAGGAGAAGCCGCTGGAGGG - Exonic
1168141848 19:54393366-54393388 CCTGAGGAAAAGGGACAGGAGGG + Intergenic
1202712212 1_KI270714v1_random:24867-24889 TCTGATGAGCTGGTACTGGAGGG - Intergenic
926104252 2:10140502-10140524 CCTGATGGGAAAGTAGTGGATGG + Intergenic
926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG + Intronic
926296400 2:11572203-11572225 TCTCCTGGGAAGGCACTGGATGG + Intronic
926632897 2:15153419-15153441 CCTCATGAGAGGGCATTGCATGG + Intergenic
927507164 2:23622067-23622089 CCTGATGAGAGGGTGCTGGAAGG - Intronic
928164365 2:28959025-28959047 CGTGATGAGAGGGGCCTGGAGGG + Intronic
933989230 2:87621760-87621782 CCTGATGAGCATCCAGTGGAAGG - Intergenic
934026175 2:88003268-88003290 CCTGAGGAGGAGGCACGGGGAGG - Intergenic
935646511 2:105340267-105340289 TCAGATGAGAAGCCACTAGAAGG + Intronic
936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG + Intergenic
936370138 2:111896991-111897013 CCTGGTGAGGAGCCACTGGTAGG + Intergenic
937082922 2:119153353-119153375 CCTGAGGAGAGGAGACTGGAGGG + Intergenic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
941279727 2:163534976-163534998 CATAATGAGAAGCCATTGGAGGG - Intergenic
941385652 2:164848059-164848081 CCAGAAGAAAAGGCACAGGAGGG - Intergenic
941696761 2:168561195-168561217 CCTGATGAAAAGAGATTGGAAGG + Exonic
943529237 2:189058454-189058476 CCTGGTGAGAAGGGAATGGCTGG - Exonic
944129795 2:196335429-196335451 GCTGATGGGCAGGCCCTGGAGGG + Intronic
944174247 2:196811998-196812020 TCAGATTAGAAGGGACTGGATGG + Intergenic
945339177 2:208631285-208631307 CCTGATAGGAGGTCACTGGATGG + Intronic
946452498 2:219792973-219792995 GCTGATGAGAAGTCCCAGGAAGG + Intergenic
946722535 2:222625618-222625640 GGTGATGAGAATGCACTGCAGGG + Intronic
946774175 2:223120189-223120211 CAGGATCAGAGGGCACTGGAGGG - Intronic
947444791 2:230155521-230155543 CCTGATGAGAAGGGTCAGGAGGG + Intergenic
948059653 2:235033412-235033434 CCTAATGTGATGGCACTGGCAGG - Intronic
948192140 2:236067901-236067923 CCAGATGAGATAGCACAGGACGG - Intronic
1170530248 20:17284080-17284102 CCAGATGAGATGGCAATGGTGGG - Intronic
1171057332 20:21920180-21920202 CCTCATGTGAAGGAAATGGAGGG - Intergenic
1171914508 20:31052981-31053003 CCTGAGTAGAATGCAATGGAAGG + Intergenic
1171915189 20:31057340-31057362 CCTGAGTAGAATGCAATGGAAGG + Intergenic
1172008314 20:31832115-31832137 CCTCATGAAGAGGCGCTGGAAGG + Exonic
1172040090 20:32038180-32038202 CCTGATGAGAAGTCATCTGAAGG - Intergenic
1172505826 20:35461729-35461751 TGTAATGAGAAGGCATTGGAAGG + Intronic
1172904695 20:38360417-38360439 CCTGAGGAGGGGGCACTGGCTGG - Intronic
1174858706 20:54070106-54070128 CATGGGGAGAAGTCACTGGATGG - Intronic
1174918454 20:54677438-54677460 TTTGATGAGAAGCCACCGGAAGG + Intergenic
1175632780 20:60556217-60556239 AGTGATGGGAAGCCACTGGAGGG + Intergenic
1175797222 20:61779372-61779394 TCTGAAGACAAGGCTCTGGAGGG + Intronic
1175883586 20:62274708-62274730 CCTGGGGAGAAGGAGCTGGAGGG + Intronic
1179404827 21:41116567-41116589 CCTGACCAGAATGTACTGGAAGG + Intergenic
1179631278 21:42680130-42680152 CCTCAGGAGAAGGCACAGGCAGG - Intronic
1180840558 22:18957037-18957059 CCTGATGCGCAGGCAGTGGCTGG + Intergenic
1181350182 22:22249599-22249621 CCTGGTCAGAAGGCAAGGGAGGG - Intergenic
1181388328 22:22560230-22560252 GCTGATGAGAAGGCAGCAGATGG + Intronic
1182043131 22:27253903-27253925 TCTGAAGTGAAGGCCCTGGATGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183044992 22:35212316-35212338 TCTGAGGAGAAGGGTCTGGAGGG + Intergenic
1183354185 22:37349621-37349643 CCTTCAGAGAAGGCACTGGGTGG + Intergenic
1183832977 22:40428827-40428849 CCTGATGAGAAGGCACTGGAAGG - Intronic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
949215169 3:1558741-1558763 ACTGATAAGAAAGCATTGGAAGG + Intergenic
949856554 3:8467180-8467202 TGTGATGGGAAGCCACTGGAGGG - Intergenic
950583039 3:13875159-13875181 ACTGAGGAGAAGCCACTGGAGGG + Exonic
952526726 3:34218404-34218426 CAATATGAGAAGCCACTGGAGGG - Intergenic
953862644 3:46558210-46558232 TCTCAGTAGAAGGCACTGGAGGG - Intronic
954368953 3:50160360-50160382 TTTGATGAGAAGTCACTGGGAGG + Intronic
954384482 3:50237065-50237087 CCTGCAGAGAAGGATCTGGAGGG - Intronic
960407598 3:117281159-117281181 CCTAAATAGAAGCCACTGGAAGG - Intergenic
960550532 3:118971466-118971488 CCTGAAAAGAAGTGACTGGAAGG + Intronic
960663399 3:120086111-120086133 ACTGCTTAGAAGGCACTGCATGG - Intronic
962487891 3:135862720-135862742 CCTGACCAGAAGGCAGTGTAAGG + Intergenic
964643383 3:158933464-158933486 GTTGAAGAGAAGCCACTGGAGGG - Intergenic
966123607 3:176549895-176549917 CCTGGTGAGAATAAACTGGAGGG - Intergenic
967116609 3:186346349-186346371 CCTCATAAGAGGGCACTAGAGGG - Intronic
967415989 3:189218977-189218999 CGTGATGGGGAGGCACTGAAGGG + Intronic
969197500 4:5574666-5574688 CCAGGTGAGAAGGTACTGGCAGG - Exonic
970156415 4:13145928-13145950 CATGAAGACAAGGAACTGGATGG + Intergenic
971226587 4:24759153-24759175 CCTGATGAAATCCCACTGGAGGG + Intergenic
971403218 4:26295526-26295548 CCTGATGAGATGTGACTGGAAGG + Intronic
971482591 4:27127634-27127656 CCTGATGAGAAGAAACGGGGTGG - Intergenic
975115295 4:70673681-70673703 TGTAATGAGAAGCCACTGGAGGG - Intronic
975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG + Intronic
976911518 4:90312923-90312945 CCTCGTCAGAAGGCACTGCAGGG + Exonic
980873874 4:138641034-138641056 CTTGAAGAGAAGGGGCTGGAAGG - Intergenic
985874252 5:2583417-2583439 CTGGCTGAGAAGGCACTGCAGGG - Intergenic
986845033 5:11742251-11742273 CCTGAAGAGAAGGAACAGGACGG - Intronic
987441767 5:17965550-17965572 CTTGGTGAGAGGGCAATGGATGG + Intergenic
988054682 5:26078811-26078833 TCTGATGAGAAGACACTGGGAGG - Intergenic
988697992 5:33643297-33643319 GCTGAGGAGAAGGCCCTAGAGGG - Intronic
988907334 5:35802853-35802875 CAGGATGAGAAGTCATTGGAAGG + Intronic
990935067 5:61139304-61139326 CATGATGAGAAGGTATTGTATGG + Intronic
990951075 5:61299037-61299059 CTAGGGGAGAAGGCACTGGAAGG + Intergenic
993793576 5:92237465-92237487 CCTTAAGATTAGGCACTGGAAGG + Intergenic
994179149 5:96744715-96744737 TGTGATGAGAAGGCTCAGGAAGG + Intronic
996108677 5:119538699-119538721 GCTGATGGGAAGGAACTGAAAGG - Intronic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
998371505 5:141664903-141664925 CATGGTGAGTAGGCACTGGCTGG - Exonic
998728874 5:145051103-145051125 TGAGATGAGAAGACACTGGAAGG + Intergenic
999674307 5:153983525-153983547 CCTGCTAAGAAGTCACAGGAAGG - Intergenic
999776613 5:154817070-154817092 GCTGCTTAGAAGGCCCTGGAAGG + Exonic
1000428460 5:161120543-161120565 ACTGGTGAGAAGACACTGAAGGG - Intergenic
1001073436 5:168606298-168606320 CCTGATGAGAAGGAAGAGGTAGG - Intergenic
1001200239 5:169709336-169709358 CCATATGAGAAGGACCTGGAGGG - Intronic
1001388211 5:171357407-171357429 CCAGATGAGCAGGCAAAGGAGGG + Intergenic
1001423818 5:171610129-171610151 TGTGATGTGAAGACACTGGAAGG - Intergenic
1001668391 5:173453038-173453060 CATGGTGAGAAAGCAGTGGATGG - Intergenic
1002537028 5:179881418-179881440 CCTGCAGAGAAGGCAGGGGATGG - Intronic
1003105094 6:3209377-3209399 GGTGATGAGTAGGCACTTGAGGG + Intergenic
1003675437 6:8200218-8200240 CCTGATGACAGGTCAGTGGAGGG + Intergenic
1005028873 6:21491014-21491036 CATGATGAGAAGGAACAAGAGGG - Intergenic
1007891787 6:45301191-45301213 CCAGATAAAAAGGGACTGGATGG + Intronic
1008739449 6:54587588-54587610 GCTGATGAGAATCCTCTGGATGG + Intergenic
1010915558 6:81613708-81613730 CCTGCTGAACAGTCACTGGATGG + Intronic
1014107635 6:117584748-117584770 CCTGGTGAGAAGTGACTGGATGG + Intronic
1017153305 6:151300582-151300604 CCTGTGGAGAAGGAAGTGGATGG + Intronic
1018397263 6:163387998-163388020 CATGAAGGGAAGGCCCTGGAAGG + Intergenic
1020982866 7:15093769-15093791 ACTGATGAGAATGCATTAGAAGG + Intergenic
1021623748 7:22572704-22572726 GATGATGTGAAGGCACAGGAAGG - Intronic
1023438308 7:40161129-40161151 CCTGAAGAGAAGTCTCTGGGAGG + Intronic
1025145258 7:56496140-56496162 CCTGATGGGACTGAACTGGAAGG + Intergenic
1028541976 7:91952545-91952567 CCAGGTGAGAAGGGAGTGGAAGG + Intronic
1029274148 7:99394213-99394235 CCTGCAGAGATGGCACTGCATGG + Intronic
1030361424 7:108599172-108599194 CCTGATTTGAAGGCATTGGCAGG - Intergenic
1030549825 7:110944588-110944610 CCTTTAGAGAAGGAACTGGAGGG - Intronic
1031879168 7:127176998-127177020 CCTGCTCAGAAGTCACGGGAGGG + Intronic
1034412149 7:150947327-150947349 CCTGTTGAGCTGGCGCTGGAGGG + Exonic
1034591506 7:152143880-152143902 GCTGCTGAGAGGGAACTGGATGG + Intronic
1035293183 7:157853076-157853098 CCAGATCAGCAGGCAGTGGATGG + Intronic
1036206261 8:6807565-6807587 CTTGGGGAGAAGGGACTGGATGG - Intergenic
1036636174 8:10551113-10551135 CCTTCTGAGAGGGCAGTGGAAGG + Intronic
1036795277 8:11751463-11751485 CCTGGGGAGAAGGGATTGGAAGG + Intronic
1042526070 8:69766291-69766313 TGGGATGGGAAGGCACTGGAGGG - Intronic
1042883702 8:73523857-73523879 TGTGATGGGAAGCCACTGGAAGG + Intronic
1043293443 8:78634096-78634118 CCTAATGAAAAGCCACTAGAGGG + Intergenic
1044894527 8:96877297-96877319 GCTGAGGAGACGGCACTGAAAGG - Intronic
1046387051 8:113519125-113519147 CCTGATGAGAATGATCTGGTGGG - Intergenic
1046876834 8:119264220-119264242 CCTGAGGAGAAGGGACTCAAGGG - Intergenic
1048431215 8:134373154-134373176 GATTATGAGAAGCCACTGGAAGG - Intergenic
1048737647 8:137519467-137519489 TCTGATGTGCAGGCACTGGTGGG + Intergenic
1050927553 9:11284599-11284621 CCTGAAGAGAAGTCACTGGGTGG + Intergenic
1051417053 9:16853006-16853028 TATGATAAGAAGTCACTGGAAGG + Intronic
1052276829 9:26686126-26686148 GCTGATGAATAGACACTGGAAGG - Intergenic
1055481306 9:76711241-76711263 CCTGATCACAAGTCACTGAAGGG + Exonic
1056684450 9:88747894-88747916 CATCATGAGAAGACACTGGTTGG + Intergenic
1056844636 9:90026590-90026612 CTTGAGGAAAAGGCACTGGTAGG - Intergenic
1056943055 9:90971644-90971666 CCTGATAAGAAAGTGCTGGAAGG - Intergenic
1056972027 9:91213293-91213315 CCTGGGGAGTAGGCACTGGTGGG - Intergenic
1058096143 9:100862482-100862504 CCTCCTGGGAAGGCAGTGGAGGG - Intergenic
1058477078 9:105347138-105347160 CCATATGAGAAGGAACTGGAAGG - Intronic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1060660184 9:125400862-125400884 ACTGATGAGAAGGCTCTCGGGGG + Intergenic
1186583517 X:10846888-10846910 CTTGATGAGAAGGCAGTTGGAGG + Intergenic
1187501566 X:19843384-19843406 ACTAATGGGAGGGCACTGGATGG - Intronic
1189966571 X:46379588-46379610 CCTGATGAAAAGCCCCTGGAAGG + Intergenic
1192252925 X:69428308-69428330 CGTGATGGGAAGCCACTGGAAGG - Intergenic
1192435256 X:71139383-71139405 CCTGGGGAGAAGGGCCTGGATGG + Intronic
1192810465 X:74542681-74542703 CTAGATGTGAAGGCACTGGGGGG + Intergenic
1193262025 X:79419016-79419038 ACTGATGAGAAGGTACTGAAGGG + Intergenic
1193269974 X:79517112-79517134 CCAGATGAGAAGGAACCAGATGG + Intergenic
1195310883 X:103630345-103630367 ACTGATGATAATGCACTGGAAGG + Exonic
1195317927 X:103696667-103696689 CCTAATGAGATGGGACAGGAAGG + Intergenic
1196795130 X:119496091-119496113 CCTGAAGAGAAGGCCTAGGAGGG - Intergenic