ID: 1183834433

View in Genome Browser
Species Human (GRCh38)
Location 22:40440631-40440653
Sequence AGCAAGTGCTCTTGGTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183834425_1183834433 25 Left 1183834425 22:40440583-40440605 CCTGCTGGGTGTCTCTCAGTTCA 0: 1
1: 0
2: 5
3: 62
4: 354
Right 1183834433 22:40440631-40440653 AGCAAGTGCTCTTGGTGCACTGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183834433 Original CRISPR AGCAAGTGCTCTTGGTGCAC TGG Intronic
902332643 1:15738127-15738149 AGCAAGGGCTCTTGGGGCTGTGG + Exonic
904290270 1:29480673-29480695 AGCAACTTCTCTTAGTGCAAGGG + Intergenic
904899411 1:33844793-33844815 AGCAAGTCCTCTTTATACACTGG + Intronic
905387206 1:37613212-37613234 GGGAAGTGCTCTTGGTCCATTGG - Intronic
909465734 1:75972233-75972255 AGCAGGTATTCTTGGTGGACTGG - Intergenic
909582495 1:77253709-77253731 AGCAAGTCCTGGTGCTGCACTGG + Intergenic
911019711 1:93374515-93374537 GGCAAGTGCTCATGCTGTACTGG - Intergenic
911600474 1:99842900-99842922 TGTATGTGCTGTTGGTGCACTGG + Intergenic
912487667 1:110041827-110041849 AGAAAGTTCTCTTGCTGCTCTGG + Exonic
913222678 1:116671574-116671596 AGGCTGTGCTCTGGGTGCACAGG - Intergenic
913692607 1:121293598-121293620 AGAAAGTGCTCTTGGTTTCCTGG + Intronic
914144949 1:144986496-144986518 AGAAAGTGCTCTTGGTTTCCTGG - Intronic
919224324 1:194675173-194675195 ATCAATTGCTGTTGGTACACAGG - Intergenic
920479927 1:206311955-206311977 AGAAAGTGCTCTTGGTTTCCTGG + Intronic
1063371991 10:5528068-5528090 ATCAAGAGCTCTTTGTGCTCAGG + Intergenic
1064505777 10:16028196-16028218 AGCATGTGCTGTTGGAACACTGG - Intergenic
1064578729 10:16772005-16772027 AGCGTGTGCTTTTGGGGCACAGG - Intronic
1065378095 10:25062802-25062824 AGCAAGTGCCTGTGGTGCAGGGG - Intergenic
1065500756 10:26380045-26380067 AGGAGGTACTCTTGGAGCACTGG - Intergenic
1065971148 10:30806822-30806844 AGCACGTCCTCATGGTGAACAGG + Intergenic
1067312024 10:45123040-45123062 AGCATGTGCTTTCGGGGCACAGG - Intergenic
1068086116 10:52375186-52375208 AGCAAGAGCACTTGGTTCCCTGG + Intergenic
1070720239 10:78751960-78751982 GGCAATGGCTCTGGGTGCACTGG - Intergenic
1070784176 10:79153604-79153626 AGCAAGTGCTCCTGTTGCCTGGG + Intronic
1072612921 10:97031073-97031095 AGGGAGGGCTCTGGGTGCACGGG - Intronic
1072659479 10:97354813-97354835 TGCAAGTGATCTTGATGCAGAGG - Intergenic
1079471734 11:20785024-20785046 AGAGAGTGCTCTTGAAGCACAGG + Intronic
1080089090 11:28323268-28323290 ACCAACTGTTCTTGGTGCAAAGG + Intronic
1083781977 11:64923473-64923495 AGCAAGTGCTCTGCTTGCTCAGG - Intronic
1085340385 11:75727524-75727546 AGCCTGTGCTCTCAGTGCACAGG - Exonic
1085388569 11:76170853-76170875 AGTCAGAGCTATTGGTGCACTGG - Intergenic
1085817869 11:79760155-79760177 AGCAAGTGTTCTAGGTGAGCGGG + Intergenic
1086063187 11:82721067-82721089 AGGAAGAGCTCTGGGTGCCCTGG - Intergenic
1088642763 11:111889360-111889382 AGCAAGTGTACTTGGTGTGCTGG + Intergenic
1088830183 11:113530235-113530257 AGCAAATGGCCTTGGTACACTGG - Intergenic
1089964141 11:122641603-122641625 AGCACGTGATCTTGGTGAAATGG - Intergenic
1091408242 12:222099-222121 AGGAAGTGCTGTTGTTACACTGG - Intronic
1093503828 12:19841618-19841640 TGCAAATGCTCTTGGATCACAGG + Intergenic
1093805369 12:23425956-23425978 GGCAGGTGCTCTGGGTGCATGGG + Intergenic
1095828369 12:46554952-46554974 AGCAAGTGCTATTGTAGCTCAGG + Intergenic
1097325141 12:58267898-58267920 AGGAAGGGCTCTTGGTCCACAGG + Intergenic
1100044937 12:90368246-90368268 AGCATGTGCTCTGGGGGCACTGG - Intergenic
1101526128 12:105532837-105532859 AGCTGGTGCTCCTGGTGCAGTGG + Intergenic
1102665368 12:114567745-114567767 AAAAAGTGGTCTTGGTGCAAGGG - Intergenic
1104728991 12:131094790-131094812 AGCAAGCCCTCCAGGTGCACGGG + Intronic
1107153828 13:37143221-37143243 AGACAGTGCTCTTGGGACACTGG - Intergenic
1111639226 13:90946877-90946899 GGCAAGTCCTCGTGCTGCACTGG + Intergenic
1113038139 13:106073884-106073906 ACCAACTGATATTGGTGCACAGG + Intergenic
1118464427 14:66017728-66017750 AGGAAGCGTTCCTGGTGCACTGG + Intergenic
1119726706 14:76925884-76925906 AAGAAGTGCTCCTGGCGCACTGG - Intergenic
1121006888 14:90496304-90496326 TGCTGGTGGTCTTGGTGCACTGG - Intergenic
1124233388 15:27966276-27966298 AGCATGTGCTCTTGATTGACAGG + Intronic
1125542506 15:40478223-40478245 AGCAAGAGCTCTAGGTGTCCTGG + Intergenic
1128556409 15:68634894-68634916 TGCCAGTGCTATTGGTCCACAGG + Intronic
1128667682 15:69550536-69550558 AGCAAGTATTTTTGGGGCACTGG + Intergenic
1131036614 15:89226690-89226712 CAAAAGTGTTCTTGGTGCACAGG - Intergenic
1131973176 15:97913158-97913180 AGCAATTTCTGTTGCTGCACTGG - Intergenic
1132672824 16:1108686-1108708 AGCAAGAGGACTGGGTGCACAGG + Intergenic
1133088250 16:3382534-3382556 AGAAAGTGTTCTTGGACCACTGG + Exonic
1135504630 16:23025794-23025816 AGCAAGTGACCCTGGTGCACTGG - Intergenic
1136867220 16:33767986-33768008 AGCAAGAGCTATTGGTGGCCCGG - Intergenic
1137523819 16:49216272-49216294 AGCAAGTGAGGTTGGTGGACAGG + Intergenic
1141790561 16:86231529-86231551 AGCAATTGCTCTTGGGGAATTGG - Intergenic
1203104942 16_KI270728v1_random:1348217-1348239 AGCAAGAGCTATTGGTGGCCCGG + Intergenic
1203128572 16_KI270728v1_random:1614151-1614173 AGCAAGAGCTATTGGTGGCCCGG - Intergenic
1147764461 17:42824323-42824345 AGCAGGAGCTCCTGGTCCACAGG + Intronic
1148867366 17:50635421-50635443 AGCAGGTGCTCTGGATGCCCTGG - Intronic
1150143918 17:62752328-62752350 AGCAAGTGCTCTGGGAGGAAGGG + Intronic
1152090145 17:78241928-78241950 TGCAAGCGGTTTTGGTGCACAGG - Intergenic
1152341792 17:79729690-79729712 AGCAAGAGCTATTGGTGGCCCGG - Intergenic
1162696361 19:12479350-12479372 AGCAAGTGCCCTGGCTGGACTGG + Intronic
1166536383 19:43577357-43577379 AGCAAGTCCTCAAGGTGAACGGG + Intronic
925565064 2:5242969-5242991 AGCAAGAGCTCTTTGAGGACAGG - Intergenic
927482320 2:23464290-23464312 AGCAAGGGCTCTGGGGGCTCCGG - Intronic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
930696948 2:54421191-54421213 AGCAAGAGATGTTGGTGCAGGGG + Intergenic
935259836 2:101344541-101344563 AGCAAGTGCTCTGGCGGCAGGGG + Intergenic
937342503 2:121100162-121100184 AGCAAGTGTTTATGGAGCACTGG + Intergenic
937832565 2:126439431-126439453 AGCATCTGCTCTAGGTGAACAGG - Intergenic
938841094 2:135164635-135164657 AGCATGTCCTCTTCCTGCACCGG - Exonic
939474264 2:142666256-142666278 AGCAACTGCTCTTGTTGAAGAGG - Intergenic
943208292 2:184928559-184928581 GGCAAGTGCTATTGCTGAACTGG - Intronic
943321105 2:186444124-186444146 AGCAACTACTCTTATTGCACTGG - Intergenic
945989481 2:216382312-216382334 AGCAAGTGCTCGTGGAGAAGGGG + Intergenic
946047976 2:216837071-216837093 AGCCAGTGCTGCTGGAGCACAGG + Intergenic
946272855 2:218608689-218608711 AACAAGTACACTTGGTACACAGG - Intronic
948606538 2:239139345-239139367 GGCAGGTGCTCTAGGTGGACAGG - Intronic
948666459 2:239537662-239537684 AGCAAGGGGGCTGGGTGCACTGG - Intergenic
948741353 2:240048589-240048611 AGGAAGTGCTCTTGGTGCCTTGG - Intergenic
1171294717 20:24007223-24007245 AACAAGTGCTCCTGGAGCACTGG + Intergenic
1173391762 20:42641647-42641669 TGCAAGTTCTCTGGGTCCACTGG - Intronic
1174385925 20:50188798-50188820 TGACAGTGTTCTTGGTGCACAGG + Intergenic
1176171282 20:63697476-63697498 AGCCAGTGCAGCTGGTGCACAGG - Exonic
1177369922 21:20189104-20189126 CGCCAGTGCTCTTGGTACAGAGG + Intergenic
1178255760 21:31051066-31051088 AGCATCTGCTCTTTGAGCACTGG + Intergenic
1179880568 21:44291757-44291779 AGGAAGAGCTCTGGGTGCAGTGG + Intronic
1181340783 22:22178276-22178298 AGAATGTACTCTTGGGGCACTGG + Intergenic
1181840871 22:25659401-25659423 AGCAAGCACTTTTGGTCCACAGG - Intronic
1182149449 22:28017994-28018016 AGCAAGTGCTGATGGGGCACAGG - Intronic
1183834433 22:40440631-40440653 AGCAAGTGCTCTTGGTGCACTGG + Intronic
950523964 3:13512918-13512940 AGCAAGCGCTCCTTCTGCACTGG - Intergenic
951280605 3:20744526-20744548 AGAAAGTGCTCTTCGTTCCCTGG + Intergenic
953364964 3:42336511-42336533 AGAAAGTGTTCTGGGGGCACAGG + Intergenic
954933949 3:54309618-54309640 AGCATGGGCTCTGGGGGCACTGG + Intronic
955815317 3:62836364-62836386 ACCAAGTGCTATTGGAGGACAGG - Intronic
964418131 3:156471551-156471573 AGCAAGTACATTTGCTGCACTGG + Intronic
966336453 3:178873249-178873271 AGCAAGTGCTCTAGGAGCCAGGG - Intergenic
966384306 3:179379223-179379245 GGAAAATGCTGTTGGTGCACTGG - Intronic
973545894 4:51981697-51981719 AGCAGTTACACTTGGTGCACTGG + Intergenic
973721641 4:53730157-53730179 AAGAAGAGCTCTTTGTGCACTGG - Intronic
975997288 4:80331036-80331058 AGAAAGTGCTCTGGGAACACAGG + Intronic
976078481 4:81326538-81326560 AGCAAATGCTCATAATGCACAGG - Intergenic
977260236 4:94788516-94788538 AGCCAGTGCTCTGGGTGGTCTGG - Intronic
978438106 4:108707512-108707534 AGCAAGTGGGCTAAGTGCACAGG + Intergenic
980113036 4:128652867-128652889 AGAAAGAGCTCTTGTTGCCCAGG + Intergenic
983130389 4:164012164-164012186 GGCAAGTCCTGTTGCTGCACTGG + Intronic
984616347 4:181902848-181902870 AGCATGTGCTCTTGGAGAACAGG + Intergenic
985952045 5:3229725-3229747 AGAAAATGCTCTCGGTGCACTGG - Intergenic
986237320 5:5924102-5924124 GGCAAATGGTCTTGGTTCACTGG + Intergenic
988921489 5:35946576-35946598 AGACAGTGCCTTTGGTGCACAGG - Intergenic
989215807 5:38903124-38903146 AGCAGGTGCTCTCTGTGCACTGG + Intronic
991979739 5:72218671-72218693 AGAAACTGCTCTTGGTGCCCTGG - Intergenic
992401269 5:76413930-76413952 AGGAAGTACACTTGGTACACTGG + Intronic
993724767 5:91354877-91354899 AACAAGTGGTCTTAGTGTACTGG - Intergenic
997395172 5:133553937-133553959 AGCCAGTGCTCTTAGTTCTCAGG - Intronic
998962606 5:147504713-147504735 GGCAAGGGCTCTGGGTGCAGAGG - Intronic
999504030 5:152176945-152176967 CGGAAGTGCTCTTGGTGAAGTGG - Intergenic
1003835487 6:10068296-10068318 AGCAAGTGAACTTGGTCCATTGG + Intronic
1003851284 6:10225407-10225429 GGAAAGTGCTCTTGGTGGAGCGG + Intergenic
1008890146 6:56478693-56478715 AGTAATCGCTCTTGGTGCAGGGG - Intronic
1017880467 6:158559555-158559577 GGAAAGTGCTTTTGGTCCACTGG + Intronic
1019883693 7:3885223-3885245 AGCGAGTGCTATAAGTGCACTGG + Intronic
1021775708 7:24053350-24053372 AGCAGGTGCTTTTGGTTTACAGG - Intergenic
1021864513 7:24941577-24941599 AGCCAGTGCTCTGGGTGAAGAGG - Intronic
1023624491 7:42102482-42102504 AGCAATTCCTGTTGGTGCAAGGG + Intronic
1024044101 7:45575612-45575634 AGCACGCGCTCTAGGTGCGCAGG - Intronic
1025149843 7:56539512-56539534 AGCAAGTGTCCCTGGTGCCCAGG - Intergenic
1025966759 7:66280200-66280222 TGCGAGTGCTCTAGGTGCTCTGG - Intronic
1031994824 7:128223051-128223073 AGCAAGAGCACTTGGTGACCTGG + Intergenic
1034374272 7:150628980-150629002 AGCAAGGCCTGTTGGTGCCCAGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1040529478 8:48254560-48254582 AGCAAGTGCTCCTGGGGAAGTGG + Intergenic
1040609473 8:48968310-48968332 TGGAGGTACTCTTGGTGCACAGG + Intergenic
1040821926 8:51569959-51569981 TGCAAGTGCTTTTGTTGCCCGGG + Intronic
1042348630 8:67752733-67752755 AGAAAGTTCTCTTGGTGCTGAGG + Intergenic
1042742442 8:72065919-72065941 AGAAAGTGCTCATGGTGGAGGGG + Intronic
1044491552 8:92823662-92823684 AGTAAGTCCTTTTGGTGCACAGG - Intergenic
1045584217 8:103513150-103513172 GGCAAGTGCTCTGGGTGAGCTGG + Intronic
1048747146 8:137626636-137626658 AGCAAGGGCTCTGTGTGCCCAGG - Intergenic
1049105103 8:140607793-140607815 AGCAGCTGCTCATGGAGCACAGG + Intronic
1056956118 9:91082895-91082917 AACAAGAGCTCTTGGTGAAATGG - Intergenic
1057501244 9:95598148-95598170 AGCACATGCTCTTGTTACACTGG + Intergenic
1058667901 9:107337254-107337276 AGCAATTGCTCCTTGTTCACGGG - Intergenic
1060146167 9:121254316-121254338 AGCAGGTGATCTTGTTTCACGGG - Intronic
1061243333 9:129387023-129387045 AGCAAATGCACTTGGTGCTGAGG - Intergenic
1061473135 9:130843512-130843534 AGCATGGGCTCTGGGTGGACAGG - Intronic
1062541318 9:137042943-137042965 AGCAAGGGCTCTGTGTGCCCAGG - Exonic
1187057302 X:15753109-15753131 AACATGTGCTCATGGTGCTCAGG - Intronic
1187567730 X:20468763-20468785 AGCAACTTGTCTAGGTGCACAGG + Intergenic
1189489084 X:41455708-41455730 AGCAATTTCTCTTCTTGCACCGG - Intronic
1189772601 X:44441429-44441451 AGCAAGTGAACCTGGTGCTCTGG - Intergenic
1189772919 X:44444111-44444133 AGCAAGTGAACCTGGTGCTCTGG - Intergenic
1191700593 X:64037968-64037990 AGCAAGTCCTATTGCTGGACTGG + Intergenic
1198368604 X:135969318-135969340 ACCAAGTGTTCTTGGTAGACTGG - Intronic
1200440050 Y:3201740-3201762 TGCAAGTTCTCTAGGTGTACTGG + Intergenic