ID: 1183844902

View in Genome Browser
Species Human (GRCh38)
Location 22:40534764-40534786
Sequence CTAGATAAACACACCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183844902_1183844903 25 Left 1183844902 22:40534764-40534786 CCATGTTTGGTGTGTTTATCTAG 0: 1
1: 0
2: 0
3: 9
4: 214
Right 1183844903 22:40534812-40534834 ATCAGCCTGTATGTGAAAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183844902 Original CRISPR CTAGATAAACACACCAAACA TGG (reversed) Intronic
900837869 1:5019804-5019826 CCAGATTAAAACACCAAAGAAGG + Intergenic
903429503 1:23282759-23282781 ACTGAGAAACACACCAAACAGGG + Intergenic
905492071 1:38352405-38352427 CCAGAAAAACATAACAAACATGG + Intergenic
905762427 1:40571320-40571342 CTAGACAAAGACACCAGGCATGG + Intergenic
906391809 1:45423686-45423708 CAAGTTAAATACAACAAACATGG + Intronic
907256923 1:53186374-53186396 CCAGACAACCACACCTAACAGGG - Intergenic
907919427 1:58898962-58898984 CTATAAAATCACACCAAACTTGG - Intergenic
911506519 1:98759157-98759179 CTACATAAACACTCCAAAGCTGG - Intronic
911751195 1:101499925-101499947 CTAGAAAAACACCAGAAACAGGG - Intergenic
911770374 1:101733273-101733295 ATAGATAAATTTACCAAACAAGG - Intergenic
912190677 1:107336411-107336433 CAAGAAAAACAAACCAAAAAAGG + Intronic
912777197 1:112513298-112513320 CAAAATAAACACCCCAGACAGGG - Intronic
915905648 1:159875015-159875037 CTGAGTAAAGACACCAAACATGG + Intronic
916253356 1:162760884-162760906 ATAGATACACACACGAATCAGGG - Intronic
916306093 1:163334925-163334947 CAAGACAAACACACAAAAAATGG - Intronic
916355722 1:163905070-163905092 CTTGATAACAAAACCAAACAAGG - Intergenic
917023673 1:170617194-170617216 CTAGATAACAACAACAAAAATGG - Intergenic
918799233 1:188951051-188951073 TCACATAAACACAACAAACATGG - Intergenic
919923880 1:202182188-202182210 CCAGAGAAACAGAACAAACAGGG + Intergenic
923314269 1:232764661-232764683 CCAGATGAAACCACCAAACAGGG - Intergenic
1064981051 10:21167048-21167070 CTCGATAATCACACTCAACAGGG + Intronic
1066174023 10:32885227-32885249 ATAGAGAAAAACACCAAATAGGG + Intergenic
1066255862 10:33678070-33678092 ATAGAAACACACACAAAACAAGG - Intergenic
1068427150 10:56881386-56881408 CTAGCTAAACCCAGGAAACAAGG + Intergenic
1068491107 10:57725058-57725080 CTACATAAACAAGCCAAATAAGG + Intergenic
1069057159 10:63856809-63856831 CTAGATAAAAACCACAAAGATGG - Intergenic
1072221765 10:93333088-93333110 CTAGATAAACATTCTAGACAGGG - Intronic
1072561116 10:96575215-96575237 CTAGAAATGCACACCAAATACGG + Intronic
1073679960 10:105692409-105692431 ATAGGGAAACATACCAAACAAGG - Intergenic
1074993656 10:118735891-118735913 CTAGATAATCAGAACAGACAAGG + Intronic
1075049676 10:119173736-119173758 CTGGATAAATACACCAAGAAAGG - Exonic
1076663724 10:132073110-132073132 CTACATACACACACACAACATGG - Intergenic
1078299341 11:10110165-10110187 CTAGATAAAAATAGCAAAAAAGG + Intronic
1080082464 11:28237719-28237741 GTAGATAAAACCACCAAAGATGG - Intronic
1080753938 11:35177353-35177375 CAAGATAATCACAACAAGCAAGG + Intronic
1083452128 11:62753222-62753244 CTAGACAAAAACTCCAAACTAGG + Exonic
1083984457 11:66203346-66203368 CTAAATAGACACACAAAAAATGG + Intronic
1084393094 11:68891323-68891345 CTCGGTAATCACAACAAACACGG + Exonic
1085591883 11:77770646-77770668 ATAAAGAAACACACCAAACATGG + Intronic
1087552509 11:99669598-99669620 CTAGAAAAATATATCAAACAGGG - Intronic
1087649653 11:100849809-100849831 ATAAATAAACACAGGAAACATGG - Intronic
1092027953 12:5258829-5258851 CTAGAGAAACAGAACTAACAGGG - Intergenic
1093264025 12:16978950-16978972 CTAAATAGACATACCTAACAGGG - Intergenic
1093769821 12:23005318-23005340 CTAGAGAAACAAAACAAATAAGG + Intergenic
1099303840 12:80930962-80930984 CTACATAAACAAACCCGACATGG + Intronic
1101782689 12:107849641-107849663 CTTCATAAACTCACCAAACATGG + Intergenic
1102091975 12:110198444-110198466 CTAAATATACACTCAAAACATGG - Intronic
1102520423 12:113474698-113474720 CTGGAAACACACACCAGACAGGG - Intergenic
1103871707 12:124096985-124097007 CTAGATCAACCCACTAAACCTGG - Intronic
1105818127 13:24055548-24055570 GTAGAGCAACACACAAAACATGG - Intronic
1106766395 13:32918089-32918111 TTAAATAAACACACCAAAAGTGG - Intergenic
1111140334 13:84109785-84109807 CAAGATCAACACATCAAACTAGG - Intergenic
1111976840 13:94975238-94975260 CTGACTAAACACTCCAAACAGGG + Intergenic
1112106342 13:96243988-96244010 CAAGATAAACAAACTAAAAAAGG + Intronic
1112847433 13:103661541-103661563 GTAAATAAGCATACCAAACAAGG - Intergenic
1113370369 13:109719208-109719230 CTATATAAACACATCATATATGG + Intergenic
1114360231 14:21963726-21963748 CTAGCTGAACAAAACAAACATGG - Intergenic
1120046511 14:79813539-79813561 ATAGATATACAAATCAAACAAGG + Intronic
1121361897 14:93269132-93269154 CCTTATAAATACACCAAACATGG + Intronic
1121920230 14:97873805-97873827 AGAGATAAACACAGCAAAGAAGG + Intergenic
1123583404 15:21736819-21736841 CTGCAGAAACACCCCAAACAAGG + Intergenic
1123620054 15:22179416-22179438 CTGCAGAAACACCCCAAACAAGG + Intergenic
1124723939 15:32138327-32138349 CTAGAAAAATAGACCAAAAAGGG + Intronic
1127288178 15:57548550-57548572 CCAGATAAACTAAGCAAACAAGG - Exonic
1130625601 15:85511230-85511252 CCAGAGAAACAGGCCAAACAAGG - Intronic
1133528126 16:6626437-6626459 ATAGATACACACACTCAACAGGG + Intronic
1134748433 16:16606031-16606053 CTTTATTAACACACCAAATAAGG + Intergenic
1134997032 16:18747588-18747610 CTTTATTAACACACCAAATAAGG - Intergenic
1135279646 16:21142898-21142920 CTCAATAAACACAACAATCAAGG + Intronic
1135459111 16:22626115-22626137 CTAGAGAAACAGAACCAACAGGG + Intergenic
1137044308 16:35641875-35641897 ATAGGGAAACACACCAAAGAAGG + Intergenic
1139816030 16:69673165-69673187 CTAGATATAGTCACCAAATAAGG - Intronic
1142613589 17:1122782-1122804 CTAGAGAAACAAAACCAACAGGG - Intronic
1142842529 17:2644625-2644647 CTACCTAAATATACCAAACACGG - Intronic
1143285715 17:5787747-5787769 ATACATAAACAAACCTAACAAGG - Intronic
1146501472 17:33368561-33368583 TTAGATAATCAAAACAAACAAGG + Intronic
1150177261 17:63071618-63071640 ATAGACAGAGACACCAAACATGG + Intronic
1150869217 17:68886320-68886342 CTAGATATAGACAAAAAACAAGG - Intronic
1151140501 17:71987117-71987139 CTAGATAAACAGTCTTAACAAGG - Intergenic
1151908092 17:77062500-77062522 CTAAATAAACAGGCCAGACATGG - Intergenic
1158233828 18:55289985-55290007 ATGAATAAACACACCACACATGG + Intronic
1158772752 18:60541098-60541120 CTAGAAAAACAGCCCAATCAGGG - Intergenic
1158983382 18:62787936-62787958 CTGGATAAAGACTCTAAACAGGG - Intronic
1159339182 18:67112643-67112665 CTAGGTATATACTCCAAACAAGG - Intergenic
1160081860 18:75735564-75735586 CCACATAAACACACAAAAGAAGG + Intergenic
1163080708 19:14939996-14940018 CTAGCTAAACTCAACAAAAATGG - Intergenic
1164584083 19:29454828-29454850 CTAGGTAAACACACCATATCTGG - Intergenic
1165560319 19:36673717-36673739 CTAGAGAAACAGAACAAACAGGG - Intergenic
1165592050 19:36977311-36977333 CTAAATAAACACTCCAAATTTGG - Intronic
1165826013 19:38706196-38706218 CGACAAAAACACAGCAAACAGGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926781133 2:16472956-16472978 CCAGAGAAACACAACTAACAGGG - Intergenic
929115641 2:38441655-38441677 CAAGATAAACATACCAGACCAGG - Intergenic
930448189 2:51500971-51500993 CTAGGTAAACAAAACAAACTGGG - Intergenic
930626402 2:53703056-53703078 CTAGAAAAACAGACAAAACCAGG + Intronic
930760844 2:55034014-55034036 ATAGAAAAACACATAAAACAAGG + Intronic
931545013 2:63373174-63373196 CCAGATAAATACTCCAAAGAGGG - Intronic
932960027 2:76402822-76402844 CCAGATCATCACACCCAACAAGG + Intergenic
933003781 2:76962432-76962454 CTAGATAAACGAACCAGAGATGG + Intronic
935498262 2:103807714-103807736 CCAGAGAAACACAACCAACAGGG + Intergenic
935610710 2:105022285-105022307 CTATATAAACAAAACAGACATGG + Intergenic
936757116 2:115728136-115728158 GTACATATATACACCAAACATGG - Intronic
939817039 2:146909098-146909120 CTAGATAAACAAAACCAAGATGG + Intergenic
940209454 2:151241597-151241619 ACAGAAACACACACCAAACAAGG - Intergenic
941499033 2:166245998-166246020 CTATAGAAATACAGCAAACAAGG + Intronic
941886552 2:170533804-170533826 CAAAATAAACACACAAGACAAGG - Intronic
942523119 2:176825378-176825400 CTAGATAAACCCCCCAGGCAGGG - Intergenic
943072911 2:183163023-183163045 CTATATAAAAACAACAAAAATGG + Intergenic
944846134 2:203669916-203669938 CTAGATATACACAACAGAAATGG - Intergenic
948959455 2:241321298-241321320 GTAGATAAACACATAAAGCAAGG - Intronic
1169258915 20:4121044-4121066 CCGAATAAACACACCAACCAGGG + Intronic
1169992544 20:11519422-11519444 CTAGACAAACTGACCAAGCAAGG + Intergenic
1170097984 20:12667991-12668013 CAAGATCAAAAAACCAAACACGG + Intergenic
1170654568 20:18274053-18274075 CTAGATGACCACAACAAACAAGG - Intergenic
1172989148 20:39019390-39019412 ACAGATAAACAAACAAAACATGG - Intronic
1173692299 20:44971210-44971232 CTAGACAATCATAACAAACATGG - Intronic
1177088927 21:16741891-16741913 CTAGATAAACATAACAAAACAGG + Intergenic
1177250956 21:18590335-18590357 CTGGAGAAAAACACTAAACAAGG + Intergenic
1178563304 21:33659337-33659359 CTAGAACAACTCACCGAACATGG - Intronic
1178851980 21:36220065-36220087 CAAAATAAACAAACAAAACAGGG - Intronic
1182899191 22:33883927-33883949 ATAGACTAACACACAAAACAAGG - Intronic
1183844902 22:40534764-40534786 CTAGATAAACACACCAAACATGG - Intronic
950880012 3:16315999-16316021 CATGATAAACACAGCATACATGG + Exonic
950909119 3:16569554-16569576 AAAAATAAACACAGCAAACATGG + Intergenic
951425933 3:22544959-22544981 CTAGAAAAAAACACCACAAAGGG - Intergenic
952493599 3:33896001-33896023 ATAGATAAACACATCACATATGG - Intergenic
954043602 3:47909964-47909986 GTAGATAACTACACCAAAGATGG - Intronic
954154987 3:48680460-48680482 CTGGATAAACACCCCCAACTAGG + Intronic
956633334 3:71337882-71337904 CCAGACAGACACTCCAAACAAGG + Intronic
958670019 3:97191826-97191848 CTAGATATATACCCCAAAGAAGG - Intronic
959183904 3:103019077-103019099 CTTTATATACACACCACACATGG - Intergenic
960911919 3:122657849-122657871 CTAGAGAAACAGAACCAACAGGG + Intergenic
962130165 3:132664083-132664105 CAGGAAAAACAAACCAAACAAGG + Intronic
963218530 3:142778935-142778957 TTTGATGAACACACAAAACATGG + Intronic
965115982 3:164488931-164488953 CTTAAAAAACACAACAAACAAGG - Intergenic
966267829 3:178067966-178067988 ATAGATAAACACAATAAAAAAGG - Intergenic
967944118 3:194788679-194788701 CTAGAGAAACAGAACCAACAGGG + Intergenic
970156767 4:13149880-13149902 CTAGAGAAAAACACAAACCATGG + Intergenic
970509852 4:16771026-16771048 CAACATAAACACAGCAGACAAGG + Intronic
971493108 4:27235274-27235296 ATAGGTAAAGACAACAAACATGG - Intergenic
971968397 4:33592217-33592239 CTAGAAAATCACACAAAAAATGG - Intergenic
972167246 4:36302178-36302200 GTAGGTAAATACACCAAACGAGG + Intronic
972289174 4:37675548-37675570 CTAGTTAGACAAAACAAACATGG + Intronic
973036690 4:45416126-45416148 CTGGAATAACACACCAAATAAGG - Intergenic
973148005 4:46853064-46853086 CTAGAAACACACATAAAACAAGG + Intronic
974191981 4:58517507-58517529 CTAGATAAAAACAGAAAACATGG + Intergenic
974499490 4:62681753-62681775 ATACATGAACACACCAAATATGG + Intergenic
974813328 4:66973709-66973731 CTACTTACAAACACCAAACAGGG + Intergenic
974829059 4:67167875-67167897 CTTGATAAAAACTCTAAACAGGG - Intergenic
975182778 4:71366035-71366057 GCAGGAAAACACACCAAACATGG + Intronic
975602206 4:76113347-76113369 CCAGATAAATATACCAGACAGGG - Intergenic
976506380 4:85852573-85852595 GTAGATAAAAACAACAAAGATGG - Intronic
977228922 4:94428372-94428394 CTACATATACACACAAGACAGGG + Intergenic
980737843 4:136914173-136914195 CTAGATAAAAACAGAAAACAGGG + Intergenic
982493596 4:156061900-156061922 ATAAATAAACAAATCAAACATGG + Intergenic
983656098 4:170086454-170086476 CTAGAGAAATACACCCAAGAGGG + Intronic
985179908 4:187248434-187248456 CTAAATGAACCCAGCAAACAAGG - Intergenic
985249414 4:188008329-188008351 CTGGAAAAATAAACCAAACATGG - Intergenic
986028821 5:3876091-3876113 CCACACAAACACCCCAAACAGGG - Intergenic
986059631 5:4175743-4175765 CTATATAAACACATGAAACAGGG - Intergenic
986445619 5:7818736-7818758 TGAGATGACCACACCAAACATGG + Intronic
989671053 5:43917530-43917552 GTAGATAAAAACAACAAAGATGG - Intergenic
989692701 5:44163808-44163830 CTAGAGAAAAAAACCAAATATGG + Intergenic
990054491 5:51554581-51554603 CCAGAGAAACAGAACAAACAGGG - Intergenic
991120606 5:63008700-63008722 GTTTATAAACACACCAATCAGGG + Intergenic
991127871 5:63088055-63088077 CTAGCCCAACACACCAAAGAAGG - Intergenic
993770585 5:91919619-91919641 CAAGATAAAAACAACAAAAATGG - Intergenic
995047325 5:107667778-107667800 CTATATAAAGACACAAAGCATGG + Intronic
996255202 5:121392675-121392697 CTAGTTAAGAAAACCAAACATGG + Intergenic
998371234 5:141662940-141662962 ACAGAAAAACACACAAAACAAGG + Intronic
998475788 5:142420416-142420438 CTAGAAAAAAAAAACAAACAGGG - Intergenic
998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG + Intergenic
1001783021 5:174386805-174386827 CCAGAGAAACACAACCAACAGGG - Intergenic
1003137779 6:3446347-3446369 CTAGATAATCATATTAAACATGG + Intronic
1005553732 6:26952084-26952106 CTAGATAAACAAAGAAAAAAAGG + Intergenic
1005699821 6:28389208-28389230 CTAAATAAACAAACAACACAAGG + Intronic
1008129964 6:47710081-47710103 ATAGAAACACACATCAAACAAGG + Intronic
1008708883 6:54199278-54199300 CATGATGATCACACCAAACATGG + Intronic
1009646379 6:66407910-66407932 CCAGAAAAACTCACCACACAAGG - Intergenic
1009961418 6:70527103-70527125 CTAGATAAACTCATAAAACTTGG - Intronic
1011778157 6:90755619-90755641 ATAGACAAATACACCAAAAAGGG - Intergenic
1016125773 6:140401007-140401029 ATATGTAAACACAACAAACAAGG - Intergenic
1017728185 6:157290459-157290481 CAAGATAAAGACAGCAAAGAAGG + Exonic
1017815601 6:158014367-158014389 ATAGAAAAACACATAAAACAAGG + Intronic
1018139296 6:160811977-160811999 CCAGAAACACACACAAAACAAGG - Intergenic
1019830010 7:3318782-3318804 CTAGAAAAACTCAACAAAGAAGG + Intronic
1022813969 7:33896175-33896197 GGAGATAAAAATACCAAACAAGG + Intergenic
1024544895 7:50508853-50508875 CCAGTTAAAGACAACAAACAAGG + Intronic
1025857054 7:65290357-65290379 CTACATAAATACACAAAACTAGG - Intergenic
1029978723 7:104858423-104858445 CTGGAGAAAGACCCCAAACATGG + Intronic
1030364571 7:108630733-108630755 CTACACAAACATACCACACACGG - Intergenic
1033289899 7:140074779-140074801 ATAGAAAAACACATAAAACAAGG - Intergenic
1033309374 7:140249412-140249434 CTAGAAAAACACATGAAACCAGG - Intergenic
1035093788 7:156335388-156335410 ACAGAAACACACACCAAACATGG - Intergenic
1035241909 7:157537764-157537786 CTGGCTAAACCCACCTAACAGGG - Intergenic
1039990560 8:42484284-42484306 CAGTATAAACACACTAAACAAGG + Intronic
1041829603 8:62139064-62139086 CCAAATAAACAAACTAAACAAGG - Intergenic
1044290837 8:90467397-90467419 CTAGTTATAAACACAAAACAAGG + Intergenic
1044722323 8:95162362-95162384 ATAGAAAAAAACAGCAAACAGGG + Intergenic
1049310053 8:141929035-141929057 CTAGAAAAAAACAGCAAACACGG + Intergenic
1051129239 9:13841084-13841106 TTAGATTAAAACACTAAACAGGG - Intergenic
1052108086 9:24545048-24545070 ATAGATAAAGACACCTAAGAGGG + Exonic
1052194089 9:25691339-25691361 AGAGATAAACAAACCAAATATGG - Intergenic
1056782081 9:89558050-89558072 ATAGAAACACACATCAAACAAGG + Intergenic
1058144190 9:101393224-101393246 CATGACAAACCCACCAAACAAGG + Intronic
1058538156 9:105984149-105984171 ATAGATAATCACAACAAATAAGG - Intergenic
1061467076 9:130789499-130789521 CAATATGAACACACCAAAAAAGG + Intronic
1186272409 X:7902957-7902979 CTCAATAAACACAACACACATGG + Intronic
1186589244 X:10912129-10912151 CAAGAGAAACACATAAAACAAGG - Intergenic
1186720051 X:12294305-12294327 CAAAAGATACACACCAAACAGGG + Intronic
1187303387 X:18073376-18073398 CTAGAAAGACACCCCCAACAGGG - Intergenic
1187699581 X:21952296-21952318 CAAGATAAACACACAAAAATGGG - Intronic
1188280628 X:28263536-28263558 CAAAATAAAAACAACAAACAAGG + Intergenic
1188593196 X:31864428-31864450 CCAGAAAAACACTCCAAAAAAGG - Intronic
1188921584 X:35985052-35985074 TTAGATAAACACACTAATAATGG - Intronic
1190836943 X:54109814-54109836 CTAAAAAAAAAAACCAAACATGG + Intronic
1190989719 X:55534445-55534467 CTAGATATAATCAGCAAACAGGG + Intergenic
1193155419 X:78167415-78167437 CTAGTTAAAAACAGCAAATAGGG - Intergenic
1194077034 X:89408197-89408219 TTAGATAAACACAGCCAAAATGG - Intergenic
1195171870 X:102276985-102277007 CTACATACACACATCAATCAAGG - Intergenic
1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG + Intronic
1195386781 X:104321106-104321128 CTGGATAAATAGACAAAACATGG + Intergenic
1196202050 X:112897424-112897446 CTATATAAACACACTAGGCATGG + Intergenic
1200429677 Y:3063732-3063754 TTAGATAAACACAGCCAAAATGG - Intergenic