ID: 1183846305

View in Genome Browser
Species Human (GRCh38)
Location 22:40543887-40543909
Sequence TTGAACAAGAACAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 10, 3: 158, 4: 625}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183846301_1183846305 2 Left 1183846301 22:40543862-40543884 CCAAGAACAGACAAGAATGAAAC No data
Right 1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG 0: 1
1: 0
2: 10
3: 158
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183846305 Original CRISPR TTGAACAAGAACAAGGTGGG AGG Intronic
900188041 1:1342160-1342182 TGCAACAAGAGCAGGGTGGGTGG + Intronic
900573020 1:3368804-3368826 TTGAAAAAGACAAAGATGGGAGG - Intronic
901175328 1:7294586-7294608 CTGAACGAGAGCAAAGTGGGTGG - Intronic
902189270 1:14750006-14750028 ATGACCAAAAAAAAGGTGGGGGG + Intronic
902442032 1:16436915-16436937 TTGAAAAAGAACAAAGTTGGAGG - Intronic
902585135 1:17434406-17434428 CTGAACATGTACCAGGTGGGTGG + Intronic
902866161 1:19281248-19281270 TTGAAAAAGAACACAGTTGGAGG - Intergenic
902882244 1:19380127-19380149 TGGAACCAGAATAAGCTGGGCGG + Intronic
903150953 1:21408317-21408339 TTGAAAAAGAACAAAATTGGAGG - Intergenic
903202841 1:21756538-21756560 TCCAAGAAGAAAAAGGTGGGTGG - Exonic
904309214 1:29615609-29615631 CTGAAAAAGAACAACGTTGGAGG - Intergenic
904537810 1:31212005-31212027 TTGAAAAAGAACAAAGTTTGAGG + Intronic
904554861 1:31353901-31353923 TTGAAAAAGAACAAAGCTGGAGG - Intronic
904692687 1:32306122-32306144 TTTCAGAAGAACAAAGTGGGAGG - Intronic
905487740 1:38316238-38316260 TTGAAGAAGAACAAACTTGGGGG - Intergenic
905593075 1:39181608-39181630 TTGAAAAAGAACAAAATTGGAGG + Intronic
906152588 1:43596220-43596242 CTGAGCAAGAACAAGGGGGTGGG + Intronic
906174367 1:43757359-43757381 TTGAAAAAGAACAAAGTTGGAGG + Intronic
906357457 1:45119273-45119295 TGGAATAAGAACAAGGGGGTTGG - Intronic
906450186 1:45939449-45939471 TTGAAAAAGAACAAAGTTGGAGG - Intronic
907239699 1:53074656-53074678 TTGGCCAATAACAAGGTGAGGGG + Exonic
907288612 1:53397950-53397972 TCAAACAAAAAAAAGGTGGGGGG + Intergenic
908172557 1:61521429-61521451 TTGAAGAAGAACAAAGTTTGAGG - Intergenic
908634717 1:66150178-66150200 TTGAAAAAGAACAAAGTTGTAGG - Intronic
909288302 1:73849421-73849443 TTGAAAAAGAATAAAGTTGGAGG - Intergenic
910161172 1:84274363-84274385 TTGAAGAAGAATAAAGTTGGAGG - Intergenic
910164928 1:84316657-84316679 TTGAAAAAGAACAGTGTTGGAGG - Intronic
910246816 1:85147988-85148010 TTGAAAAAGAACAGAGTTGGAGG - Intergenic
910350517 1:86291873-86291895 TTGAAAAAGAACAAAGTTAGAGG - Intergenic
910625749 1:89304610-89304632 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
910712716 1:90198400-90198422 ATTAACAAGAACAAGTTGGCAGG - Intergenic
910839069 1:91544582-91544604 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
911215756 1:95191399-95191421 CTGAAAAAGAACAAAGTTGGAGG - Intronic
911296240 1:96119031-96119053 TTGAGGAAGTACAAGGTGGGAGG - Intergenic
911348949 1:96728626-96728648 TTGAAAAAGAACAGAGTTGGAGG - Intronic
911699703 1:100938166-100938188 TTGAAAAAGAACAAGGTTGCAGG - Intronic
912578541 1:110698829-110698851 TTGAGCAAGAACAAAGCTGGAGG + Intergenic
912697633 1:111853423-111853445 TAGAACCAGAACAATCTGGGGGG + Intronic
912929653 1:113945787-113945809 TTGAAAAAGAACAAAGTTGGAGG - Intronic
912946015 1:114084972-114084994 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
913483024 1:119307515-119307537 TTGAATAAGAACAAAGTTGGAGG - Intergenic
914351900 1:146847230-146847252 TTGAAGAAGGAAAAGGTGGGAGG - Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914782171 1:150795408-150795430 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
915377141 1:155406354-155406376 TTGAAAAAGAACAAAGTTGAAGG + Intronic
915388265 1:155517150-155517172 TTGAAAAATAACAAAGTTGGAGG + Intronic
916736827 1:167615114-167615136 TTGAAAAAGAACAAAATTGGAGG - Intergenic
917258163 1:173138891-173138913 ATCAACAATAACAAGGTGGAGGG + Intergenic
917551758 1:176039646-176039668 TTGAAAAAGAACAAAGATGGAGG + Intronic
917568521 1:176237260-176237282 CTGAAGAAGAACAAAGTTGGAGG - Intergenic
917594787 1:176518061-176518083 TTGAAACAGGCCAAGGTGGGAGG + Intronic
917670647 1:177270480-177270502 ATGAACAAGATGATGGTGGGGGG + Intronic
917983603 1:180292113-180292135 TTGAAAAAGAATAAAGTTGGAGG - Intronic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
919570151 1:199238246-199238268 TTGAAAAAGAGCAAAGTTGGAGG - Intergenic
919585190 1:199429573-199429595 TTGAGAAAGAACAAAGTTGGAGG + Intergenic
919867995 1:201797458-201797480 TTGAAAAAGAACAAAGTTGGAGG - Intronic
920193795 1:204212876-204212898 TTGAAGAACAACAAGGAGGTGGG - Intronic
920719570 1:208374676-208374698 TTGACCCAGAAACAGGTGGGTGG - Intergenic
921023053 1:211254192-211254214 TAGAAAAAGAACAAAGTTGGAGG - Intergenic
921093279 1:211863438-211863460 TTGAAGGAGAACAAAGTTGGAGG - Intergenic
921216963 1:212946081-212946103 TTGAGCAAGGACATGGTGGCTGG - Intergenic
921980640 1:221254014-221254036 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
922017051 1:221659136-221659158 TTAAAAAAGAACAAAGTTGGAGG - Intergenic
922181434 1:223236792-223236814 TTGAAGGAGAACAAAGTGGGAGG - Intronic
922379051 1:225002558-225002580 TTGAATAAGAACAAAATAGGAGG - Intronic
922640783 1:227229447-227229469 TTGAAAAAGAGCAAAGTTGGAGG - Intronic
922990385 1:229904261-229904283 TTGAAAAAGAACAAAGTTAGGGG + Intergenic
923138236 1:231137549-231137571 TTGAAAAAGAACAAAGTTGAAGG - Intergenic
923152674 1:231247628-231247650 TTTATGAAGAACAAGGTGGATGG - Intronic
923608088 1:235463525-235463547 TTGAAAAAGAACAAGGTTGGAGG + Intronic
1065365538 10:24932830-24932852 GTGAAAAAGAACAAAGTTGGAGG + Intronic
1065407523 10:25386376-25386398 TTGAAAAAGAACTAAGTTGGAGG - Intronic
1065470132 10:26071103-26071125 TTGAGAAAGAACAAAGTTGGAGG + Intronic
1066138544 10:32477780-32477802 TTGAAGAACAACAAAGTTGGAGG - Intronic
1066248258 10:33606027-33606049 TTGAAGAAAAACAAAGTTGGAGG - Intergenic
1066511465 10:36102855-36102877 TTGAAGAAGAACAAAGTTGGAGG + Intergenic
1067040253 10:42948461-42948483 TTGAAAAAGGATAAAGTGGGAGG + Intergenic
1067194488 10:44103944-44103966 TTGAAAATGAACAAAGTTGGAGG + Intergenic
1067319846 10:45207470-45207492 TTGAAGGAGAACAAAGTTGGAGG - Intergenic
1068382360 10:56273221-56273243 ATGAGCAAGAACAAGGATGGAGG + Intergenic
1068803719 10:61171400-61171422 AGGAACATAAACAAGGTGGGAGG - Intergenic
1068815799 10:61310652-61310674 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1070141499 10:73741432-73741454 TAGAAAAAAAAAAAGGTGGGGGG + Intergenic
1070309048 10:75260079-75260101 TTGAAAAAGAACAAAGTAGGAGG - Intergenic
1070640763 10:78167403-78167425 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1070673599 10:78396366-78396388 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1070993977 10:80759191-80759213 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1071242290 10:83721048-83721070 TTGAAAAAGAACAAAGTCGGAGG + Intergenic
1072142144 10:92598531-92598553 TTGAAAAAGAACAAAGCTGGAGG - Intronic
1072178792 10:92958744-92958766 TTGAAGAAGAACAAAGTTGGAGG + Intronic
1072203140 10:93179066-93179088 TTGAGGAAGAACAAGTTTGGTGG + Intergenic
1072429386 10:95357403-95357425 TTGAAGGAGAACAAGGTTGGGGG + Intronic
1072467046 10:95674011-95674033 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1072696378 10:97606682-97606704 TAAAAAAAGAACAAAGTGGGAGG - Intronic
1072703728 10:97664687-97664709 TTGAACAAGAGCCAGGTCAGAGG + Intronic
1074252696 10:111768133-111768155 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1074271629 10:111959323-111959345 TTGAACAAAAACAGAGAGGGTGG + Intergenic
1074411839 10:113235403-113235425 TTGAACAAGGAGAATGGGGGTGG + Intergenic
1074486154 10:113883102-113883124 TTGAAAAAGAAGAAAGTGGGAGG - Intronic
1074605965 10:114966419-114966441 TTGAAAAAGAACAAGTTGGAGGG - Intronic
1074802249 10:117012317-117012339 CTGAATAAGAACAAAGTTGGAGG + Intronic
1074832609 10:117260141-117260163 TGAAACAGGAACATGGTGGGAGG - Intronic
1074955957 10:118389676-118389698 TTGAAAAAGAACAGAGTTGGAGG - Intergenic
1075025666 10:118981396-118981418 TTGAAGATGACCAAGGTGGCCGG + Intergenic
1075833720 10:125434737-125434759 TTAAATAAGAACAAAGTTGGAGG + Intergenic
1076592422 10:131593597-131593619 TTGAAAAAGAACACAGTTGGAGG - Intergenic
1076592739 10:131598297-131598319 TTGAAAAAGAACACAGTTGGAGG - Intergenic
1076812604 10:132896816-132896838 TTGAAAAAGAACAAAGTTGGAGG + Intronic
1077114813 11:879231-879253 AAGAAAAAGAATAAGGTGGGTGG - Intronic
1077290783 11:1790822-1790844 TTGAAGAAGAACAAAGTTGGAGG - Intergenic
1077657287 11:4032478-4032500 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1077924651 11:6669032-6669054 TTGAAAAAGAACAAAGCTGGAGG - Intergenic
1078050245 11:7959355-7959377 TTGAAGAAGAACAAAGTTGGAGG - Intergenic
1078801764 11:14652419-14652441 TTGAAAAAGAACAAAGTTTGAGG - Intronic
1079047114 11:17115171-17115193 ATGAAAAAGAACAAAGTAGGAGG + Intronic
1079147966 11:17870785-17870807 TTAAAAAAGAACAAAGTAGGAGG + Intronic
1079379580 11:19926017-19926039 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1079551412 11:21703559-21703581 TTGAATAAGAACATGGGGGTAGG - Intergenic
1079996668 11:27302562-27302584 GTGAAGAAGAACAAGGTGTAGGG - Intergenic
1080194879 11:29597750-29597772 TTGAAAAAGAACTAAGTTGGAGG + Intergenic
1080573398 11:33577253-33577275 GAGAAGAAGAACAAGGTGTGGGG + Intronic
1081271631 11:41091778-41091800 TTGAACACTAACCAGGTGGCTGG + Intronic
1081344722 11:41970183-41970205 TTTAAAAAGAACAAAGTTGGAGG + Intergenic
1081624312 11:44639100-44639122 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1081697888 11:45129833-45129855 TTGAAGAAGAATAAAGTTGGAGG + Intronic
1081725680 11:45326828-45326850 TTGAAAAAGAACAAGATTGGAGG - Intergenic
1081791070 11:45785550-45785572 TTGAAAAAGAACAAATTTGGAGG - Intergenic
1083133086 11:60645466-60645488 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1083424074 11:62574010-62574032 TGGAAAAAGAACTGGGTGGGTGG + Exonic
1084566857 11:69934667-69934689 TTGAAAAAGAAAATGTTGGGGGG + Intergenic
1085169021 11:74432239-74432261 TTGAGAAAGAACAAGGTAGAAGG + Intergenic
1085954462 11:81374504-81374526 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1087808661 11:102585058-102585080 TTTAAAAAGAACAAAGTTGGAGG - Intronic
1088212039 11:107466953-107466975 CTGAAGAAGAACAAAGTTGGAGG - Intergenic
1088296576 11:108303369-108303391 TTGAATAAGAAAAAGGAGTGGGG + Intronic
1088629854 11:111764341-111764363 TTGAAGAAGACCAATGTGAGGGG - Intronic
1088677589 11:112210793-112210815 TTAAACTAGAATAAGGTTGGTGG + Intronic
1088863610 11:113825086-113825108 TTGAAAAAGAACAAAGTTGAAGG + Intronic
1089628452 11:119767546-119767568 TTGAAAAAGAACAAAGTTAGAGG - Intergenic
1090219291 11:125002836-125002858 TTGAAAAAGAACAAAGTTAGGGG - Intronic
1092535907 12:9386873-9386895 CTGACAAAGAACAAGGTGGGAGG - Intergenic
1092561729 12:9621409-9621431 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1092653806 12:10663653-10663675 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1092680439 12:10973961-10973983 TTTAAAAAGAACAAAGTGGGGGG + Intronic
1093122466 12:15288534-15288556 TTTAAAAAGAACAAAGTTGGAGG + Intronic
1093136238 12:15455011-15455033 TTGAAAAAGAACAAAGCTGGAGG - Intronic
1093534284 12:20203942-20203964 TTGAAAAAGAACAAAATTGGAGG - Intergenic
1094140640 12:27178303-27178325 ATGAACAAAAAGAAGGTTGGAGG - Intergenic
1095085939 12:38057398-38057420 AAGAAAAAGAAAAAGGTGGGGGG + Intergenic
1095725837 12:45452168-45452190 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1095925268 12:47572452-47572474 TTGGAAAAGAACAAAGTTGGAGG - Intergenic
1096039760 12:48503589-48503611 TTGAAGAATAACAAAGTAGGGGG + Intergenic
1096058357 12:48674680-48674702 GTGCACAAGGCCAAGGTGGGTGG + Intronic
1096409759 12:51368701-51368723 TTGAAGAAGGAAAAAGTGGGCGG - Intronic
1096442347 12:51654628-51654650 TTGAAAAAAAACAAAGTTGGAGG - Intronic
1096593374 12:52677308-52677330 TTGTACCAGAGCAAGGTGAGTGG - Exonic
1096612058 12:52808678-52808700 CTGTACCAGACCAAGGTGGGTGG - Exonic
1096617888 12:52844551-52844573 TTGTACCAGACCAAGGTGGTGGG - Exonic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1098413749 12:70209357-70209379 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1098461014 12:70732962-70732984 TGGAACACGTACAAGGTGGTAGG + Intronic
1098644013 12:72875473-72875495 CTGAAAGAGAACAAAGTGGGAGG - Intergenic
1098711110 12:73763294-73763316 TTGAAGAAGAACAAAATTGGAGG - Intergenic
1099180997 12:79472694-79472716 TTGAACAATATCATGGGGGGCGG - Intergenic
1100025822 12:90126686-90126708 AGGAAAAAGAACAAAGTGGGAGG + Intergenic
1100107882 12:91199510-91199532 TTGAAAAAGAACAAAGTTGAAGG - Intergenic
1100337481 12:93645253-93645275 TTGGAGAAGACCAAGTTGGGTGG + Intergenic
1100835461 12:98562964-98562986 TTGAAGAAGAGCAAAGTTGGAGG + Intergenic
1101241428 12:102843423-102843445 TTGAACAGGGACCAGGTGGCAGG + Intronic
1101649558 12:106662999-106663021 TTGAAGAAGAACAAAATTGGTGG - Intronic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1102150736 12:110687967-110687989 TTGAGTAAGACCAAGGTGAGGGG - Exonic
1102403939 12:112655923-112655945 TTGAACAAGAACAAAGTGACTGG - Intronic
1104740818 12:131172094-131172116 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
1104916506 12:132267568-132267590 TTGAAAAAGAACCAAGCGGGAGG + Intronic
1105370625 13:19798782-19798804 TTGAAAAATAACAAAGTTGGAGG + Intergenic
1105684105 13:22760622-22760644 CTGAAAAAGAACAAGGCTGGAGG + Intergenic
1105716355 13:23069099-23069121 TTTAAAAAGAACAAGGTGGAGGG + Intergenic
1106139134 13:26996739-26996761 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1106150154 13:27092418-27092440 TTGAAGAAGAACAAAGTCAGAGG + Intronic
1107742606 13:43468102-43468124 TTGAAAAAGAACAATGTTAGAGG - Intronic
1107767491 13:43752804-43752826 TTAAAAAAGAAGAAGGTTGGAGG - Intronic
1108109990 13:47059654-47059676 TTGAAAAAGAACAATGTTAGAGG - Intergenic
1108435101 13:50394209-50394231 TTGAAAAACAACAAAGTTGGGGG + Intronic
1108480269 13:50862669-50862691 TGGAAAAAGAACAAAGTTGGAGG + Intergenic
1109111213 13:58320339-58320361 TTTACTAACAACAAGGTGGGTGG - Intergenic
1109277406 13:60317861-60317883 GGGAACAAGACCAAGGTGTGAGG + Intergenic
1111326176 13:86699223-86699245 TTGAAGAAGAACAAGGTTAGAGG + Intergenic
1111891938 13:94093541-94093563 TTGAGCAAGAACAAAGCTGGAGG - Intronic
1112041102 13:95548982-95549004 TTGAACAACCCCAGGGTGGGGGG + Intronic
1112131806 13:96532875-96532897 TGGAACAAAAAGAGGGTGGGAGG + Intronic
1112564228 13:100538682-100538704 TTGGAAAAGAACAATGTTGGAGG - Intronic
1113080284 13:106512379-106512401 TTGAAAAAAAAAAAGGGGGGGGG + Intronic
1113511798 13:110862295-110862317 TTGAGGAAGAACAAAGTTGGAGG - Intergenic
1113826362 13:113257550-113257572 ATGAGCAAGAACAGGGAGGGAGG + Intronic
1114490752 14:23100259-23100281 AAGAAGAAGAAAAAGGTGGGGGG + Exonic
1115054127 14:29101687-29101709 TCGACAAAGTACAAGGTGGGAGG - Intergenic
1115887578 14:37990935-37990957 TTGTAAAAGAACAAAGTTGGAGG + Intronic
1115929989 14:38480342-38480364 TTTAACAAGAACAAATTTGGAGG - Intergenic
1116016147 14:39409518-39409540 TTGAAAAAGAACAAAGCTGGAGG - Intronic
1116147347 14:41091525-41091547 ATGAATAATAATAAGGTGGGAGG - Intergenic
1116209402 14:41914187-41914209 TTGAAAAAGAACAAAGTTAGTGG - Intergenic
1116343590 14:43758356-43758378 TTGGACAATAAAAAGGCGGGAGG + Intergenic
1116519889 14:45834648-45834670 ATGAACAAGATCATAGTGGGAGG + Intergenic
1116775060 14:49169655-49169677 TTGAGAAAGAACAAAGTTGGAGG - Intergenic
1116866851 14:50038297-50038319 GTGAACAAGAGTCAGGTGGGCGG - Intergenic
1117312790 14:54544999-54545021 TTTAAAAAGAACAAAGTTGGAGG - Intergenic
1118035680 14:61864039-61864061 TTGAAGAAGAACAAAGTTGGAGG - Intergenic
1118082601 14:62378557-62378579 TTGAAAAAGAATAAAGTAGGTGG + Intergenic
1118260430 14:64241394-64241416 TTGAAAAAGAACAAACTGGGAGG - Intronic
1118313828 14:64712265-64712287 TTGAAAAAGAACCAAGTTGGGGG - Intronic
1118369148 14:65121870-65121892 TTGAAAAAGAACAAAGCTGGAGG - Intergenic
1118561004 14:67082569-67082591 GTGAAAAAGAACAAAGTTGGAGG - Intronic
1118682215 14:68254287-68254309 TTACATAAGAACAGGGTGGGAGG + Intronic
1118778957 14:68993377-68993399 TCAAAAAAGAAAAAGGTGGGAGG + Intergenic
1118803792 14:69216382-69216404 TGGAAAAAGAACAAGATGGCAGG - Intronic
1118813350 14:69291500-69291522 CTGACCAAGAGCAGGGTGGGTGG - Intronic
1118882663 14:69842555-69842577 TGGAACTAGAACAAAGAGGGTGG - Intergenic
1118976328 14:70680113-70680135 TGGAAAAAGAACAAAGTAGGAGG + Intergenic
1119117452 14:72038335-72038357 TTGAAAAAGAACAGAGTTGGAGG - Intronic
1119277715 14:73374261-73374283 TTTAAAAAGGCCAAGGTGGGAGG - Intronic
1119371317 14:74146730-74146752 TTGAAAAAGAACAAAGTTGAAGG + Intronic
1120051716 14:79874839-79874861 TTCAAGAATAACAAGGTGGCTGG + Intergenic
1120110820 14:80553584-80553606 CTGAAGAAGAACAAGGTAAGGGG - Intronic
1120212757 14:81650177-81650199 ATGAGCAATAACAAGGTAGGCGG - Intergenic
1121430862 14:93887278-93887300 TTGAAGAAGAACAAAGTCAGAGG - Intergenic
1121899726 14:97683012-97683034 TTAACCAAGACCGAGGTGGGTGG + Intergenic
1121933590 14:97995914-97995936 TTGAACCAGATCAGTGTGGGAGG - Intergenic
1122618781 14:103040979-103041001 TTGAAAAACAACAAAGTTGGAGG + Intronic
1122648573 14:103211445-103211467 TTGAAAAAGAACAATGTGGCCGG - Intergenic
1122746488 14:103900001-103900023 GTGAAGAAGAGCACGGTGGGTGG + Intergenic
1123100888 14:105799360-105799382 TTGAAGAAGAACAAAGTTAGAGG + Intergenic
1124056802 15:26248073-26248095 TTGAAAAAGAACAAAGCTGGAGG - Intergenic
1124146439 15:27130482-27130504 TTGAAGAAGAACAAAGTTGGGGG - Intronic
1124148081 15:27149538-27149560 TTGCAGAAGAACAAAGTTGGAGG + Intronic
1124418997 15:29502174-29502196 TTGAAAAAGAACAAAGTGAGAGG + Intronic
1124949127 15:34300174-34300196 TTGAACGACAACAAGGAAGGTGG + Intronic
1125251933 15:37714383-37714405 CGGAACAGGACCAAGGTGGGAGG - Intergenic
1126452243 15:48821003-48821025 TTTAAAAAGAACAAGGTGGGAGG - Intergenic
1126986842 15:54321348-54321370 TTGAAAAAGATCTTGGTGGGTGG - Intronic
1127070907 15:55287803-55287825 TTGAAAAAGAACAAGGTTGGAGG + Intronic
1127171610 15:56308985-56309007 TTGAAAAAGAACAAAGTTGAAGG - Intronic
1127345497 15:58093510-58093532 TTGAGGATGAACAAGATGGGAGG + Intronic
1127345894 15:58097869-58097891 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1127731284 15:61804359-61804381 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
1127738488 15:61871544-61871566 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1128526822 15:68418075-68418097 TTGAAAACGACCATGGTGGGAGG + Intronic
1128935859 15:71745977-71745999 TTGAAGAAGAACAAGGGGAAAGG + Intronic
1129058635 15:72841627-72841649 TTGTAAAAGAACAAAGTTGGAGG - Intergenic
1129115265 15:73362074-73362096 GTGAACAGGAAGAAGCTGGGTGG - Intronic
1129773779 15:78220040-78220062 TTGAAAAAGAACAAAGTTGAAGG + Intronic
1129950386 15:79582892-79582914 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1130008428 15:80126340-80126362 TTGAAAAATAACAAAGTTGGAGG + Intronic
1131345567 15:91644730-91644752 TTGAACAACAAGACGGTGAGTGG - Intergenic
1131701897 15:94946274-94946296 TTGGAAAAGAACAAAGTTGGAGG - Intergenic
1131959687 15:97775865-97775887 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
1132168725 15:99624611-99624633 TTGAAAAAGAACAAAGTTGAAGG - Intronic
1132171454 15:99660946-99660968 CTGAAGAAGAACAAGGTGAGAGG + Intronic
1132765261 16:1531275-1531297 TGGAACAAGAAGCAGATGGGCGG + Intronic
1133083281 16:3340892-3340914 TTGAAAAAAAACAAAGTGGGAGG - Intergenic
1133408388 16:5546372-5546394 TTGAAGAAGAACAAAGTTAGAGG + Intergenic
1133684494 16:8153270-8153292 TTGAAAAAGAACAAAGTTGGTGG - Intergenic
1134122004 16:11591146-11591168 TTGAAAAATAACAAAGTTGGAGG + Intronic
1134240881 16:12505674-12505696 TTGAAAAAGAACAAAGCTGGAGG - Intronic
1134411743 16:14008625-14008647 TTCAAAAAGAACAAAGTTGGAGG - Intergenic
1134793856 16:17016275-17016297 TGGAATAAGAACAAAGTTGGAGG - Intergenic
1135027190 16:19007441-19007463 ATGAGCAAGAACCTGGTGGGCGG - Intronic
1135696710 16:24594255-24594277 TTTAAAAAGAACAACGTTGGAGG - Intergenic
1136240585 16:28941090-28941112 TACAACAAAAACAGGGTGGGAGG - Intergenic
1137507871 16:49070786-49070808 TTAAAAAAGAACAAAGTTGGAGG - Intergenic
1137689823 16:50415636-50415658 TTGAAAAAGAACAAAGGTGGAGG - Intergenic
1137818436 16:51421467-51421489 TACAACAAGAACAATATGGGGGG + Intergenic
1138355688 16:56378143-56378165 TTGAAGAAGAACAAAGTTGGAGG + Intronic
1139626077 16:68189252-68189274 TTGAAAAAGAACAGAGTTGGAGG - Intronic
1139982133 16:70868306-70868328 TTGAAGAAGGAAAAGGTGGGAGG + Intronic
1140609612 16:76582216-76582238 TTGAAGAAGAGCAAGGTAGGAGG - Intronic
1140809462 16:78563418-78563440 TTGAACAATAACAACGTAGGAGG + Intronic
1142588788 17:991576-991598 TTGGAGAAGAGCAAGGTAGGAGG + Intergenic
1143207154 17:5151535-5151557 TTGAAGAAGAATAAGGTATGAGG + Intronic
1143308096 17:5964684-5964706 TTGAATAAGAATAAGGTTAGGGG - Intronic
1143573628 17:7776875-7776897 ATGAAGAAGAACCAGGTGAGAGG + Exonic
1143825586 17:9603859-9603881 TTGAAGAAGAACACAGTTGGAGG + Intronic
1144333628 17:14248764-14248786 GTAACCAAGAAGAAGGTGGGAGG - Intergenic
1144565671 17:16357145-16357167 TTGAAGAAGAACAAATTTGGAGG + Intergenic
1144799621 17:17916708-17916730 TTTAAAAAGAACAAAGTTGGAGG - Intronic
1144940282 17:18934311-18934333 TTGAAAAAGAACAAAGTTTGAGG + Intergenic
1145178550 17:20723620-20723642 TTAAAAAAAAAAAAGGTGGGTGG - Intergenic
1145290216 17:21538202-21538224 CTGAAAAAGAACAATGTTGGAGG + Intronic
1146479171 17:33190584-33190606 TTGAAAAAGAACAATGTTGACGG + Intronic
1146954130 17:36927009-36927031 TTGAACATGAGCAAGATGGTAGG + Intergenic
1147912912 17:43867928-43867950 TTGATAAAGAACAAAGTTGGAGG - Intergenic
1149674175 17:58444276-58444298 TTGAAAAAGAACAAAGTTAGAGG + Intronic
1149835200 17:59906299-59906321 TTGAAAAAGAACAAAGGTGGAGG - Intronic
1149972436 17:61232385-61232407 TTGGCCAAAAAAAAGGTGGGGGG + Intronic
1149977054 17:61276757-61276779 TTGAAAAAGAACAAAGTTGAAGG + Intronic
1150012739 17:61521082-61521104 TTGAAAAAGAACAAAGTTGAAGG - Intergenic
1150112935 17:62518030-62518052 TTGAAAAAGAACTAAGTTGGAGG - Intronic
1150174469 17:63036548-63036570 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1150189200 17:63219885-63219907 TTGAAAAAGAACAAAGTTGGAGG + Intronic
1150664379 17:67118083-67118105 TTGAAAAAGAACAACGTTGGAGG + Intronic
1152326275 17:79640509-79640531 TTGAACAAGAACAAAGCGGGAGG + Intergenic
1152845392 17:82596623-82596645 TTTAAAAAGAACAAAGTTGGAGG - Intronic
1152939191 17:83157841-83157863 TTGAAAAAGAACAAATTTGGAGG - Intergenic
1153342018 18:3984988-3985010 TTTAACAAAAACAATGAGGGTGG - Intronic
1153432650 18:5035707-5035729 TAGAAAAAGAACAAAGTTGGAGG - Intergenic
1153461593 18:5339827-5339849 TTGAAAAAGAACAGAGTTGGAGG - Intergenic
1153548030 18:6229914-6229936 ATGAAAAAGAACAAAGTTGGAGG - Intronic
1153792518 18:8592599-8592621 TTAAAGGAGAACAAGGTTGGAGG + Intergenic
1154408547 18:14120101-14120123 TTGAAAAAGAACAAAGCTGGGGG + Intronic
1154938219 18:21083375-21083397 TTGAAAAAGAACAAAGTTAGAGG + Intronic
1154986058 18:21552177-21552199 TTGAAGAACAACAAAGTTGGAGG + Intronic
1155519548 18:26655924-26655946 TGGAAAAAGAACGGGGTGGGGGG - Intronic
1155672254 18:28386273-28386295 TTGAAAAAGAACAAGCATGGAGG + Intergenic
1155856176 18:30837913-30837935 TTGAAAAAGAACAAAGCTGGAGG - Intergenic
1157120742 18:44908629-44908651 TTGAAAAAGAACAAGGTTGGAGG - Intronic
1157765896 18:50297531-50297553 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1158032098 18:52978403-52978425 TTCAACAAGAAAGAGGTGGTCGG + Intronic
1158209251 18:55027954-55027976 TTGAAAAAGAACAAAATTGGAGG + Intergenic
1158262032 18:55617372-55617394 TTGAGAAAGAACAAAGTTGGAGG - Intronic
1159179183 18:64879538-64879560 TTGAATAAGAACAAAGCTGGAGG + Intergenic
1159291603 18:66430462-66430484 TTGAAAAAGAACAAATTTGGAGG + Intergenic
1159330180 18:66983133-66983155 TTGAAAGAGAACAAAGTTGGAGG - Intergenic
1159333818 18:67037113-67037135 TTGAAGAAGAATAAGTTGGGAGG - Intergenic
1159979279 18:74756259-74756281 TTGAAAAAGAATAAGGTTGAAGG - Intronic
1161018525 19:1996243-1996265 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1161537693 19:4830460-4830482 TTTAAAAAGGACAAGGTGGGAGG - Intronic
1161558714 19:4958655-4958677 TTTAAAAAGATCAAGGTGGAAGG - Intronic
1161629758 19:5347518-5347540 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1163056472 19:14723362-14723384 TTGAAAAAGAACAGAGTTGGAGG - Intronic
1163060477 19:14757427-14757449 TTGAAGAAGAACAAGAAGGTTGG + Intronic
1163401740 19:17098052-17098074 GTGAAGAAAAAAAAGGTGGGGGG - Intronic
1164436576 19:28235794-28235816 TTGAAGAAGAAGTAAGTGGGTGG + Intergenic
1165298831 19:34954136-34954158 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
1165791294 19:38494269-38494291 TTGGACCAGAACAATGTGGAAGG - Intronic
1165853550 19:38865954-38865976 TTTAACAACAACGCGGTGGGTGG + Intergenic
1165876451 19:39011026-39011048 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1166405247 19:42516697-42516719 TTGAAAAAGAACAAAGTTGAAGG + Intronic
1166415053 19:42589265-42589287 TTGACCAAGAATAAGAGGGGAGG - Intronic
1167400080 19:49260109-49260131 TTGACAAAGAACAATGTCGGAGG + Intergenic
1167516257 19:49924730-49924752 ATGAACTAGAACAGGCTGGGAGG + Intronic
1167805910 19:51785165-51785187 TTGAAGAAGAACTTGGTGGGTGG - Intronic
1167890562 19:52536316-52536338 TTTAAAAAGAACGGGGTGGGTGG - Intronic
925113561 2:1356613-1356635 TTGAGAAAGAACAAAGTTGGAGG - Intronic
925338965 2:3120717-3120739 TTGAAAAAGAACAAAGTTTGAGG + Intergenic
925663623 2:6229571-6229593 TTGAAAAAGAACAAACTTGGAGG + Intergenic
926130285 2:10298868-10298890 TTGAAAAAGAACAAGGCTGGAGG + Intergenic
926684314 2:15687005-15687027 TTGAAGAAGAACATGTGGGGTGG + Intergenic
928004566 2:27552526-27552548 TTGAAAAAGAACAAAGTTGGAGG - Intronic
928180724 2:29066586-29066608 CTGAACAAGATCGAGGTGGGTGG + Intronic
928343771 2:30470704-30470726 CTGAAAAAGAACAAAGTTGGAGG - Intronic
928901938 2:36328749-36328771 TTGAAAAAGAACATAGTTGGAGG + Intergenic
928974743 2:37073811-37073833 TTGAAAAAGAACAAAGTTGGAGG + Intronic
929181249 2:39042198-39042220 TTGAGGAAGAACAAGTTGAGGGG - Intronic
929230675 2:39556659-39556681 TTAAAAAAGAACAAGGCGGCTGG - Intergenic
929628420 2:43434057-43434079 TTAAAGAAGAACAAGGTTGGAGG + Intronic
929633370 2:43489797-43489819 TTGAAAAAGAACAAAGTTGGAGG - Intronic
929675302 2:43920842-43920864 CTAAACAATAAAAAGGTGGGTGG + Intronic
929715805 2:44308285-44308307 TTGAAAAATAACAAAGTTGGAGG - Intronic
929906731 2:46052706-46052728 TTGAAAAAGAACACAGTTGGAGG + Intronic
930155396 2:48102401-48102423 TTGAAAAAGAACCAGCTGGGAGG + Intergenic
930436415 2:51349421-51349443 TTGAAAAAGAATGAGGTTGGAGG + Intergenic
930891616 2:56395526-56395548 TTGAAGAAGAACAAAGTGAGAGG - Intergenic
930907237 2:56586124-56586146 TTGAAAAAGAACAAACTTGGAGG - Intergenic
931896687 2:66739557-66739579 TTGAAAAATAACAAAGTGAGAGG - Intergenic
931917455 2:66973015-66973037 CTGAAAAAGAACAATGTTGGAGG + Intergenic
932069440 2:68603188-68603210 TTGAAAAAGATCAAGGCTGGAGG + Intronic
932160843 2:69458168-69458190 GTGAACAAGAGAAAGGAGGGGGG - Intronic
932560788 2:72866858-72866880 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
933226850 2:79759654-79759676 TGGAACCAGAAAAAAGTGGGAGG - Intronic
933628117 2:84625424-84625446 TTGAACATGAAATATGTGGGAGG + Intronic
933872792 2:86585796-86585818 TTGAAAGAGAACAAAGTTGGAGG + Intronic
934072998 2:88402686-88402708 TTGAAAAAGAATAAAATGGGAGG + Intergenic
934879340 2:97960344-97960366 TTAAACATGAAGAAGGTGGATGG - Intronic
934914178 2:98285684-98285706 TTGAAAAAGAACAAATTTGGAGG - Intronic
934931245 2:98426067-98426089 TTGAAAAATAACAAAGTGAGAGG + Intergenic
934953550 2:98596593-98596615 TTGAAAAAGAACAAAGCTGGAGG + Intergenic
935104949 2:100032960-100032982 TTGAAAAAGAATAAGGTTGTTGG - Intronic
935241751 2:101184532-101184554 TTGAAAAAGAATAAAGTTGGAGG - Intronic
935723616 2:106001842-106001864 TTGAAAAAGAAAAATGTTGGGGG - Intergenic
935919355 2:107994281-107994303 TACAGCAAGAACTAGGTGGGGGG + Intronic
936272923 2:111065057-111065079 TTGAAAAAGAATAAAGTGGGAGG + Intronic
936990411 2:118358474-118358496 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
937372732 2:121312778-121312800 TTGAAAAAGAACAAATTTGGAGG + Intergenic
937833801 2:126451254-126451276 TTGAACAAGAACAAAGCTGGAGG - Intergenic
938857146 2:135325199-135325221 TTGAAAAAGAACAAAGTTGAAGG + Intronic
939138740 2:138327696-138327718 TTGAAGAAGAATAAAGTTGGAGG + Intergenic
940010114 2:149044067-149044089 TTGAAAAAGAATAAAGTTGGAGG - Intronic
940304653 2:152212567-152212589 TTTAAGAAGAACAAAGTTGGGGG - Intergenic
941287363 2:163630662-163630684 TTGTACAAAAAAAAGGGGGGGGG + Intronic
941485585 2:166076590-166076612 TTGAAGAAGAACAAAGTTGGAGG + Intronic
942012815 2:171780133-171780155 TTGAAAAAGAACAAAGTTAGAGG + Intergenic
942032159 2:171973311-171973333 TTGAAAAAGAACAAAATTGGAGG - Intronic
942180592 2:173376890-173376912 TTGAAAAAGAACAAAGTTAGAGG - Intergenic
942439009 2:176012590-176012612 TTTAACAAGAACAAAGTTGGAGG - Intergenic
942724208 2:178988709-178988731 TTGAAAAAGAACAAATTCGGAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943071410 2:183144775-183144797 TTAAACATTAACTAGGTGGGGGG + Intronic
943233433 2:185287709-185287731 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
943328310 2:186528082-186528104 TTGAAAAAGAACAAATTTGGAGG - Intergenic
943430446 2:187793777-187793799 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
943982994 2:194579046-194579068 TTGAAAAAGTACAAAGTTGGAGG - Intergenic
944158841 2:196638083-196638105 TTGAAAAAGGACAAAGTTGGAGG + Intergenic
944291363 2:198009622-198009644 TTGAAAAAGAACAAAGTCAGAGG - Intronic
944640617 2:201721363-201721385 TTGAAAAAGAACAAATTTGGAGG + Intronic
944812099 2:203337686-203337708 TTGAATAAGAACAAAGTTGGAGG + Intronic
944908981 2:204290772-204290794 TTGAAAGAGGACAAGGTGGCTGG + Intergenic
945208959 2:207362578-207362600 TTGAAAAAGAACAAAGTTAGAGG - Intergenic
945403022 2:209410783-209410805 TAGAAAAAGAACAAAGTTGGAGG + Intergenic
945530619 2:210949986-210950008 TTGAAAAACAACAAAGTTGGTGG + Intergenic
945929022 2:215836317-215836339 GTAAACAAAACCAAGGTGGGTGG - Intergenic
946293295 2:218762418-218762440 TTGAAAAAGAACAAAGTCAGAGG - Intergenic
946629447 2:221650350-221650372 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
947387187 2:229602926-229602948 TTGAATAAGAACAATGTGGGAGG + Intronic
947805319 2:232963100-232963122 TTTAATAAGAACAAAGTAGGAGG + Intronic
948741972 2:240054118-240054140 CTGAACAAGGACAGGGTGGATGG - Intergenic
948744274 2:240074920-240074942 TTGAAAAAGAACAATGAGGTGGG - Intergenic
948780183 2:240315991-240316013 TTGAAAAAGAACAAATTTGGAGG + Intergenic
1169043122 20:2512369-2512391 TTGAAAAAGAATAAGGTTGGAGG + Intronic
1169127971 20:3144231-3144253 TTGAAAAATAACAAAGTTGGAGG + Intronic
1169310065 20:4529769-4529791 TTGAGCAAGAACAAAGCTGGAGG + Intergenic
1169431749 20:5542489-5542511 TTGAGCAAGAAGCAAGTGGGAGG - Intergenic
1169448745 20:5693481-5693503 TTGCACACAAAAAAGGTGGGCGG + Intergenic
1169810002 20:9600290-9600312 TTGAAAAAGAACAATGTTAGAGG - Intronic
1169825318 20:9761594-9761616 TTGAGCAAGAACAAGAAGGCTGG + Intronic
1169833009 20:9845874-9845896 TTCAAGAAGAATAAGGTGGGAGG + Intergenic
1170646940 20:18205847-18205869 TTGAAGAAGAACAAAGTCAGAGG + Intergenic
1170956729 20:20987630-20987652 ATGAAGAAGAACAGGGTTGGAGG + Intergenic
1171435817 20:25123369-25123391 TTGAAAAAGAATAAAGTTGGAGG + Intergenic
1172078813 20:32321591-32321613 CTGAAAAAGAACAAGGCTGGAGG - Intronic
1172423687 20:34839513-34839535 TTGAAAAAGAACAATGTTGGAGG - Intergenic
1172635953 20:36410073-36410095 AGGAACAGGAACAAGGTGGATGG - Intronic
1172643778 20:36457459-36457481 TTGAACCAGAACCAGGGAGGCGG - Intronic
1173164364 20:40676185-40676207 TTGACCAAGAAGGAAGTGGGGGG + Intergenic
1173629751 20:44503311-44503333 TTGAAAAAGAACAAATTTGGAGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174116470 20:48229843-48229865 GAGAACCAGAACAAGGTGGGTGG - Intergenic
1175101258 20:56580321-56580343 GTCAAAAAGAACAAGGTGGGTGG + Intergenic
1175792614 20:61751157-61751179 TAGAACAAGAAAAAGATGGGAGG + Intronic
1176150803 20:63589782-63589804 TTGATCAGGAGCCAGGTGGGCGG - Exonic
1177291320 21:19116811-19116833 TTGAAAAAGAACAAAGCTGGAGG - Intergenic
1178237609 21:30860715-30860737 TTCCACAAGAACCAGGTGGAAGG + Intergenic
1179155358 21:38845780-38845802 TTGAAAAAGAACAAATTTGGAGG - Intergenic
1179332163 21:40413660-40413682 TTGAATAAGAACAAAGTGAAAGG + Intronic
1179434823 21:41353357-41353379 TTGAAAAAGAACAAAGTTGCAGG + Intronic
1179806560 21:43841876-43841898 TTGAAAAAGAAGAAAGTTGGGGG - Intergenic
1179963121 21:44782492-44782514 TTGAAAAAGAACAAAGTTGGCGG + Intronic
1180114456 21:45690058-45690080 TTGGAAAAGAACAAAGTTGGAGG + Intronic
1180654142 22:17404781-17404803 TTGAAAATGAACAAAGTGAGAGG - Intronic
1180825740 22:18859608-18859630 TTGAAAAAAAAAAAGGGGGGGGG + Intronic
1181548432 22:23619465-23619487 TTGAAAAAGAACAGTGTTGGAGG + Intronic
1182636885 22:31735141-31735163 TTAAAAAAGAACAGGGTGGCGGG + Intronic
1183251579 22:36733979-36734001 TTGGACAAGAGCAGGGTTGGGGG + Intergenic
1183790396 22:40063359-40063381 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG + Intronic
1183980475 22:41536889-41536911 TTTAAAAAAAAAAAGGTGGGGGG + Intronic
1184237896 22:43195102-43195124 TTGAAAAAGAACAAAATTGGAGG - Intergenic
1184641454 22:45873816-45873838 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1184945487 22:47800934-47800956 TTGAAAAAGAACAGAGTTGGAGG + Intergenic
1185307904 22:50132250-50132272 TTGAAAAGGAACAAAGTTGGAGG - Intronic
949224367 3:1676004-1676026 TTGAAAAAGAACAAAGTTAGAGG - Intergenic
949893514 3:8751804-8751826 TTGAAAAAGAACAAAGTTGGTGG - Exonic
950052336 3:10002041-10002063 TTGAAAAAGAGCAAAGTTGGAGG - Intronic
950059542 3:10058783-10058805 TTGAAAAAGAACAAAGTTGGAGG - Intronic
950301085 3:11879607-11879629 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
950696934 3:14708464-14708486 TTGAAAAAAAAAAAAGTGGGAGG - Intronic
950727919 3:14930284-14930306 TTAAAAAAGAACTAGGTTGGAGG - Intronic
950735060 3:15000613-15000635 TTGAAAAAGAACAAAGTTGGAGG - Intronic
951021514 3:17785892-17785914 TTGACCAAGAACAAAGCTGGAGG - Intronic
951292255 3:20886703-20886725 TTGAAAAAGAACAAAGTTGAAGG - Intergenic
952521719 3:34166634-34166656 TTTAAAAAGAACAAAGTAGGTGG - Intergenic
953223309 3:40993984-40994006 TTGAAAAAGAACAGGGTTAGAGG - Intergenic
953256428 3:41295000-41295022 TTGAAGAAGAACAAAGTTGGAGG + Intronic
953895842 3:46800173-46800195 TTGAAAAAGAACACAGTTGGAGG + Intronic
953971379 3:47350574-47350596 TTGAAAAATAACAAAGTTGGAGG - Intergenic
954475850 3:50745000-50745022 TTGAAAAAGAATAAAGTTGGAGG - Intronic
954889470 3:53911251-53911273 TTGAAAAAGAACAAGGTTGGGGG + Intergenic
955561960 3:60201043-60201065 TTAAAATAGAACAACGTGGGTGG + Intronic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
955751440 3:62188791-62188813 ATAAATAAGAACATGGTGGGAGG + Intronic
955989366 3:64609830-64609852 TTGAAAAAGAACAAAGCTGGGGG + Intronic
956261374 3:67346257-67346279 TTAAAAAAGAACAAAGTTGGAGG + Intergenic
956428680 3:69163056-69163078 TTAAACAAGAAAAAAGTGGCCGG + Intergenic
957524774 3:81366025-81366047 TTGAAAAAGAACAAAGCTGGGGG + Intergenic
958032865 3:88134102-88134124 TTAAAAAAAAAAAAGGTGGGGGG + Intronic
958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG + Intergenic
959062781 3:101631226-101631248 TGCAATAAGAACAATGTGGGAGG + Intergenic
959535401 3:107479223-107479245 TTGAAAAAGAACAAGGTTGAAGG + Intergenic
959852306 3:111103087-111103109 TTGAAGAAGAACAAAGTCAGAGG - Intronic
959927746 3:111943097-111943119 TTGAACGAGAACAAAGTTGGAGG + Intronic
960020377 3:112945272-112945294 TTGAAGAAGAACAAAGTTTGAGG + Intronic
960084217 3:113573404-113573426 TTGATCAAGAACAAGGCTGTGGG + Intronic
960646959 3:119896152-119896174 TTGAAAAAGAATAAAGTTGGAGG - Intronic
960661489 3:120064709-120064731 TTGAAAAAGAACGAAGTTGGAGG + Intronic
960822973 3:121753860-121753882 TTCAAGAAGAACAAAGTTGGAGG + Intergenic
961174653 3:124824135-124824157 TTGAAAAAGAACAAAGTTGGAGG + Intronic
961505052 3:127364996-127365018 TTGGAAAAGAACAAGTTTGGAGG - Intergenic
961908651 3:130290260-130290282 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
961915651 3:130371376-130371398 TTGAAAAAGAACAAAGTTGAAGG + Intronic
962141411 3:132794433-132794455 TTGAAAAAGAAGAAAGTTGGAGG + Intergenic
962825582 3:139097374-139097396 CTGAAAAAGAACAAAGTTGGAGG - Intronic
962982254 3:140501147-140501169 GAGAACAAGAGCAAGGTGGGTGG - Intronic
963053890 3:141167492-141167514 TTCATAAAGAACAAGGTTGGAGG - Intergenic
963077775 3:141363445-141363467 TTGAAAGAGAACAAAGTTGGTGG + Intronic
964525721 3:157613727-157613749 TTGAACAAAAACCAGGGTGGGGG + Intronic
964797824 3:160519012-160519034 TTGAAGAAGAACAAAGTTTGAGG - Intronic
966392430 3:179466480-179466502 TGGCAGAAGAACAAGGAGGGAGG - Intergenic
966845284 3:184124268-184124290 TTGAAAAGGTAAAAGGTGGGGGG + Intergenic
966987393 3:185194123-185194145 CTGAAAAAGAACAAAGTTGGAGG + Intronic
967842120 3:194014305-194014327 ATGAACAAGAACATGGTGAGGGG + Intergenic
968024871 3:195432625-195432647 TTGAAAAAGAACGAAGTTGGAGG - Intronic
969159235 4:5240984-5241006 TTGAAGAAGAACAGGATGGAAGG - Intronic
970955835 4:21810361-21810383 TTGGGCAAAAAGAAGGTGGGAGG - Intronic
971240899 4:24887910-24887932 CTGAACAGGAACATGGAGGGCGG - Intronic
972443870 4:39124369-39124391 TTGAACAAGAATAAAGTTGAAGG + Intronic
972466538 4:39362346-39362368 TTGAAAAAGAACAAAGGTGGAGG + Intronic
972547079 4:40090221-40090243 TTGAAAAAGAACAAAGCAGGAGG - Intronic
974854918 4:67449484-67449506 TTGGAAAAGAACAAAGTTGGAGG + Intergenic
975470980 4:74767623-74767645 TTGAGCAAGAACAAAGTTGGAGG + Intronic
975833431 4:78394645-78394667 TTGAGCAAGAACAAAGCTGGTGG - Intronic
975896283 4:79095349-79095371 TTGAACAAGAACAAAGCTGGGGG - Intergenic
975996039 4:80316764-80316786 TTAAAAAAGAAGAAAGTGGGAGG + Intronic
977739708 4:100463852-100463874 TTGAAAAAGAACAAAGTTAGAGG - Intronic
978204731 4:106067925-106067947 TTGAAAAAGAACAAAGTCAGAGG - Intronic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
979580761 4:122356741-122356763 AAGAAAAAGAAAAAGGTGGGTGG + Exonic
979590629 4:122475681-122475703 TTGAACAAGAAAAAGATAGATGG - Intergenic
979873613 4:125858403-125858425 TTGAAAAAGAACCAAGTTGGAGG - Intergenic
980201465 4:129660522-129660544 TTGAAGAAGAAGAAAGTTGGAGG - Intergenic
980512342 4:133811178-133811200 TTGAATAAGAGCAAAGTTGGAGG - Intergenic
980589800 4:134870701-134870723 GTAAACAAGAAAAAGGTGAGTGG - Intergenic
980690146 4:136285349-136285371 TTGAAGAAGAACAACGTCAGAGG + Intergenic
981705092 4:147650686-147650708 TTGAAAAAGAACAAAGTTGGAGG + Intronic
982239576 4:153285373-153285395 TTGAAAAAGAACAAAATTGGAGG - Intronic
983191406 4:164757855-164757877 TTGAGAAAGAACAAAGTAGGAGG - Intergenic
983288788 4:165773639-165773661 TGAAAGAAGAATAAGGTGGGAGG - Intergenic
983298416 4:165895726-165895748 TAAAAGAAGAAAAAGGTGGGAGG + Intronic
983560911 4:169100581-169100603 TTGAAGGAGGCCAAGGTGGGTGG - Intronic
983595175 4:169458106-169458128 TTGAAGGAGAACAAAGTTGGGGG + Intronic
983790514 4:171791998-171792020 TTGCACAAGGACAAGGTCAGGGG + Intergenic
984754036 4:183308420-183308442 TTGAAGAAGAATAAAGTTGGAGG + Intronic
984868409 4:184305382-184305404 TTGAAAAAGTACAAAGTTGGTGG + Intergenic
984942493 4:184945256-184945278 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
985060508 4:186073010-186073032 TAGAAGAAGAGCAAGATGGGAGG + Intronic
985714887 5:1450563-1450585 TTGAAAAAGAACAACATTGGAGG + Intergenic
985756528 5:1722795-1722817 TTCAAAAAGAAAATGGTGGGGGG - Intergenic
986117354 5:4790121-4790143 ATGAAGAAGAACAAAGTTGGAGG + Intergenic
987091835 5:14514747-14514769 TTGAAAAAAAATAAAGTGGGGGG - Intronic
987163361 5:15168473-15168495 TAGAACAGAAACAATGTGGGTGG - Intergenic
988528133 5:32004090-32004112 TTAAAAAAAAAAAAGGTGGGGGG + Intronic
989013063 5:36896366-36896388 TTGAAAAAGAACAAAGTTGGAGG - Intronic
989402261 5:41021491-41021513 TTGAAGAAGAACAAAGTTGGAGG + Intronic
990245005 5:53855826-53855848 TTGAAGAAGAACAAAGTTGGAGG + Intergenic
990443855 5:55874345-55874367 TTGAAAAAGAACACAGTTGGAGG - Intronic
990477998 5:56180355-56180377 TTGAAAAAGAATAAAGTGGAAGG - Intronic
990559440 5:56968926-56968948 TTGAAAAAGAACAAAGTTGAAGG - Intronic
990643727 5:57819183-57819205 TAGAAAAAGAACAAAGTTGGAGG - Intergenic
990893207 5:60670565-60670587 TTGAAAAAGAACAAAGTTGGAGG + Intronic
991032900 5:62101113-62101135 TGGAATAAGAACCAGGTGGAAGG + Intergenic
991340111 5:65599790-65599812 TTGAAAAAGAAAAAAGTTGGAGG + Intronic
991537608 5:67689472-67689494 TTGGAAAAGAACAAAGTTGGAGG + Intergenic
992668805 5:79038108-79038130 TTGAAAAAGAACAAAGTTGGAGG + Intronic
994738790 5:103592783-103592805 TTAAAGAAGAACAAAGTTGGAGG - Intergenic
994793483 5:104262840-104262862 TTGAAGGAGAACAAAGTTGGAGG + Intergenic
995281478 5:110340397-110340419 ATTAAAAAGAACAAGTTGGGAGG + Intronic
995553820 5:113307095-113307117 CTGAAGAAGAACAAAGTTGGAGG - Intronic
995571086 5:113483208-113483230 TTGAAAAAGAACAAAGTTGGAGG - Intronic
995643867 5:114289277-114289299 TTGAAAAAGAACAAAATTGGAGG - Intergenic
995702230 5:114949169-114949191 TTGAACAGGAAGAACTTGGGAGG - Intergenic
996066061 5:119080530-119080552 TTGTATAAGAAAAATGTGGGAGG - Intronic
996270041 5:121593258-121593280 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
996993754 5:129668941-129668963 TTGAAAAAGAACAAAGCTGGAGG + Intronic
997117657 5:131142941-131142963 TTTAAAAAGAACAACGTTGGAGG + Intergenic
997170954 5:131720051-131720073 TTGAAAAAGAACAAAGCTGGTGG + Intronic
997291708 5:132741162-132741184 TTGAAAAAGAAGAAAGTTGGAGG - Intergenic
997452856 5:133997408-133997430 ATCAAAAAGAATAAGGTGGGTGG + Intronic
997935867 5:138110472-138110494 TTGAGAAAGAATAAGGTGTGGGG + Intergenic
997936480 5:138116435-138116457 ATGAAAAAGAACAAAGTTGGAGG + Intronic
998076685 5:139242249-139242271 TTGAAAAAGAACAAAGTTTGAGG + Intronic
998552668 5:143092547-143092569 TTGAGAAAAAAAAAGGTGGGGGG - Intronic
998686608 5:144534289-144534311 AGCAAAAAGAACAAGGTGGGAGG + Intergenic
998969619 5:147576912-147576934 TTGAACAACTACAATGTGGCAGG - Intergenic
999960522 5:156751063-156751085 TTGAACAAGAATAAGGTAAGAGG + Intronic
1000019249 5:157304409-157304431 TTTAATAAGAAGAAGGTGAGAGG - Intronic
1000167168 5:158662802-158662824 CTGAAGAAGAACAAAGTTGGAGG + Intergenic
1000861065 5:166456676-166456698 TTAAAAAAAAAAAAGGTGGGGGG - Intergenic
1000873172 5:166602636-166602658 TAGAACTAGAAGAAGGTAGGAGG + Intergenic
1000933045 5:167275299-167275321 TTAAAAAAGAAGAAAGTGGGAGG - Intergenic
1001552534 5:172614127-172614149 TTGAGCAAGAACAAAGCTGGAGG + Intergenic
1002003575 5:176214032-176214054 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1002191360 5:177479425-177479447 TTAAAGAGGAACAAGGCGGGAGG - Intergenic
1002222883 5:177696884-177696906 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1003091104 6:3104037-3104059 TTTAAAAAGAACAAGGTTGTAGG - Intronic
1004353812 6:14914115-14914137 TTGAAAAAGAACTAAGTTGGAGG + Intergenic
1004620600 6:17327150-17327172 AGGAAAAAGAAAAAGGTGGGGGG + Intergenic
1004779336 6:18890037-18890059 TTGAAAAAGAACAAAGCAGGAGG - Intergenic
1004933010 6:20479786-20479808 ATGGACAAGAACAAGAAGGGAGG - Intronic
1004961602 6:20796537-20796559 TTGAATAAGAATAAGGTTGGAGG + Intronic
1005429358 6:25738133-25738155 TTGAAAAAGAATAAAGTGGTAGG + Intergenic
1005698402 6:28373425-28373447 TTGAAAAAGAATAAAGTGAGAGG - Intergenic
1005907005 6:30270819-30270841 TTCAACAAGAACAAAGCTGGAGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007050204 6:38820135-38820157 TTGAAGAAAAGCAAGGTAGGGGG + Intronic
1007241960 6:40432701-40432723 GTGAACAACAACCAGCTGGGCGG - Exonic
1007639247 6:43324142-43324164 TTGAAAAAGAACAAGGTTGGTGG + Intronic
1007867632 6:44990485-44990507 TTGAGAAAGAACAAAGTGGGAGG - Intronic
1008234864 6:49032452-49032474 TAGAAAAAGAACAAAGTTGGAGG + Intergenic
1008820992 6:55630285-55630307 TTGGACAAGAATGGGGTGGGTGG + Intergenic
1010394156 6:75371525-75371547 TTGAAAAATAACAAAGTTGGAGG + Intronic
1010770726 6:79826466-79826488 TTGAAGAAAATCAAAGTGGGAGG + Intergenic
1011087996 6:83564053-83564075 TTGAAAAAGAACAAATTTGGGGG + Intronic
1011094654 6:83646640-83646662 TTGAAGAAGAACAAAGTTGAAGG - Intronic
1011561179 6:88617625-88617647 TTGAGAAAGAACAAAGTTGGAGG - Intronic
1011566268 6:88676108-88676130 TAGAAAAAGAACAAAGTTGGAGG + Intronic
1011776924 6:90740691-90740713 TTGAAAAAGAACAAAGCTGGAGG - Intergenic
1012258206 6:97058182-97058204 TTGAAGGAGAACAAAGTTGGAGG - Intronic
1012634639 6:101522612-101522634 TTCAAGAAGAAGAAGGTTGGTGG + Intronic
1012822190 6:104099920-104099942 TTGAAGAAGAACAAAGTCAGAGG + Intergenic
1012871557 6:104678764-104678786 CTGAAAAAGAACAAAGTTGGAGG + Intergenic
1012891678 6:104904149-104904171 TTGAAGAAGAACAAAGTTGGAGG - Intergenic
1012960026 6:105612574-105612596 TTGACCAAGACCCAGCTGGGAGG + Intergenic
1012965816 6:105671478-105671500 TAAAACAATAACAAGGGGGGGGG + Intergenic
1013001468 6:106027059-106027081 TTGTGGAAGAATAAGGTGGGTGG - Intergenic
1013248309 6:108309422-108309444 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1013320534 6:108983681-108983703 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1013683791 6:112554913-112554935 TTGAAGAAGAACAAAGTTGGAGG - Intergenic
1014679774 6:124413490-124413512 TTGAAAAAGAACAAAATTGGAGG - Intronic
1015641895 6:135343444-135343466 TCGAAAAAGAACAAGGTTGAAGG + Intronic
1015977739 6:138807958-138807980 TTTAAAAAGAACAAAGTGGTTGG - Intronic
1016229120 6:141780934-141780956 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1016365690 6:143315374-143315396 TTGAAGAAGAACAAAGTAGGAGG + Intronic
1017144646 6:151223450-151223472 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1017397655 6:154021399-154021421 TTGAAGAAGCACAAAGTTGGAGG - Intronic
1017424826 6:154309575-154309597 TTCTCCAAGAACAAGGAGGGCGG - Intronic
1018852949 6:167654291-167654313 TTTAGGAAAAACAAGGTGGGTGG - Intergenic
1019141523 6:169948747-169948769 TTGAAAAAGAACAAAGCAGGTGG + Intergenic
1019406820 7:888389-888411 ATGACCAGGAACAAGGTCGGAGG - Intronic
1019600269 7:1879600-1879622 TTGAAAAAGAACAAAATTGGAGG + Intronic
1019754065 7:2755204-2755226 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1020407419 7:7853260-7853282 TTGAAAACGAACAAAGTTGGAGG - Intronic
1020688396 7:11324549-11324571 TTGAAAAAGAATAAATTGGGAGG + Intergenic
1021080659 7:16360418-16360440 TTGAAAAAGTACAAAGTTGGAGG + Intronic
1021278394 7:18685018-18685040 TTTAACAACAAAAAAGTGGGAGG - Intronic
1021753547 7:23828738-23828760 TTGAAAAAGAACAAGTCAGGGGG - Intronic
1021851517 7:24813383-24813405 GTGAATGAGAACAAGGTAGGTGG + Intronic
1022016619 7:26355260-26355282 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1025232468 7:57211759-57211781 GTGAACAAGAACATGGGGGTGGG + Intergenic
1025850874 7:65242652-65242674 TTGAAAAAGAACAAAGTAAGAGG - Intergenic
1025962327 7:66233625-66233647 TTAAAAAAGAACAAAGTTGGAGG - Intronic
1026020752 7:66703735-66703757 TTGAAAAAGAACAAAGTTGGAGG - Intronic
1026021630 7:66712030-66712052 TTGAATAAGAATAAAGTTGGAGG - Intronic
1026554683 7:71396556-71396578 TGAAAAAAGAACAAGGTGAGAGG - Intronic
1026883980 7:73926503-73926525 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1026885460 7:73940191-73940213 TTGAGCAAGAACAGCATGGGAGG - Intergenic
1028354794 7:89893555-89893577 TTGAAAAAGAACAAAATTGGAGG - Intergenic
1029096948 7:98093181-98093203 TTGAAAAATAACAAAGTTGGAGG - Intergenic
1029263545 7:99320892-99320914 ATGGACAAGTACAAGGTGTGTGG - Intergenic
1029374475 7:100169706-100169728 TTTAAAAAAAACAAGGTGGGGGG - Exonic
1029401990 7:100352538-100352560 TGGAACAGCAGCAAGGTGGGTGG - Intronic
1029804278 7:102980167-102980189 TTGAAAAAGAACAAAGTTGGAGG + Intronic
1030151462 7:106410229-106410251 TTGAAAAAGAATAAAGTAGGAGG + Intergenic
1030209660 7:106983604-106983626 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1030778782 7:113571326-113571348 TTAAACAAGAAAAAGGAGGTGGG + Intergenic
1031092598 7:117377747-117377769 TTGAAAAAGAACAAAATGGGAGG + Intronic
1032042140 7:128571965-128571987 TTGAAAAAGAACTAAGTTGGAGG - Intergenic
1033353428 7:140580935-140580957 TTTAAAAATAACAAGCTGGGTGG - Intronic
1034249803 7:149679860-149679882 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1034482778 7:151335579-151335601 TTGACCAAGAAAAAGCTGGCAGG + Intergenic
1034953894 7:155321191-155321213 TTGAAAAAGAACAAAGTTAGAGG - Intergenic
1035046013 7:155966239-155966261 TTGTAAAAGAACAATGTTGGAGG + Exonic
1035576129 8:707031-707053 TTGAAAAAGAACAAAGTTGAGGG + Intronic
1035944509 8:3946469-3946491 TTTAAAAAGAACAAAGTGGGAGG - Intronic
1036394451 8:8356739-8356761 TAGAAAAAGAACAAAGTTGGAGG + Intronic
1036697430 8:10986572-10986594 TTGAGCAAGAAAAAAGTGTGTGG + Intronic
1036734812 8:11303151-11303173 TTGAAGAACAAAAAGGTGAGAGG + Intronic
1037240225 8:16768959-16768981 TTGAAAAAGAAGAAAGTTGGAGG - Intergenic
1038451654 8:27643261-27643283 GTTACCAAGAACAGGGTGGGAGG + Intronic
1038941981 8:32315064-32315086 TTAAAAAAGAAAAAGTTGGGTGG - Intronic
1039312702 8:36336017-36336039 TTGAAGAAGAACAAAATTGGAGG + Intergenic
1039448649 8:37653017-37653039 TTGAAAAAGAACCAAGTTGGAGG + Intergenic
1039680811 8:39733925-39733947 CTGAAAAAGAACAAAGTTGGAGG + Intergenic
1039684848 8:39789498-39789520 TTAAATAAGAACAAAGTTGGAGG + Intronic
1040370928 8:46773000-46773022 TTGAAAAAGAACAAACTTGGAGG - Intergenic
1040525054 8:48214994-48215016 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1040762537 8:50867423-50867445 TTGAACAAGAACAACTTTGGAGG - Intergenic
1040793634 8:51264726-51264748 TTGAAGAAGGACAAAGTGGGAGG - Intergenic
1041061551 8:54039706-54039728 TAGAAAAAGAACATGGAGGGGGG - Intergenic
1041478572 8:58293036-58293058 CTGAAAAAGAACAAGGTAGGAGG - Intergenic
1041503236 8:58562396-58562418 TCGAAAAAGAACAAAGTGGGAGG + Intronic
1041768283 8:61443679-61443701 TTGAAAAAGAATAAAGTGGAAGG - Intronic
1041844586 8:62313235-62313257 TTGATCAAAAACAGGGTGAGAGG - Intronic
1041892876 8:62890973-62890995 CTGAAAGAGAGCAAGGTGGGAGG + Intronic
1042071107 8:64935050-64935072 TTGAAAAAGAATAAAATGGGAGG - Intergenic
1042251532 8:66760628-66760650 TTGAAAATGAACAAAGTGGCCGG - Intronic
1042521596 8:69717535-69717557 TTGACAAAGAACAAAGTTGGAGG - Intronic
1042627528 8:70774822-70774844 TTGAAAAAGAACAAAGTTGCAGG - Intronic
1043043703 8:75294522-75294544 TTGAACAAGAACAATTTGCTGGG - Intergenic
1043073732 8:75669376-75669398 TTGTAGAAGAACATAGTGGGAGG + Intergenic
1045070304 8:98497002-98497024 TTGAAAAAGAACAAAGTTGGTGG + Intronic
1047642014 8:126830853-126830875 TTGAATAAGAACAGAGAGGGTGG + Intergenic
1048249753 8:132853192-132853214 TTCAAGAAGAACAAAGTTGGAGG + Intergenic
1048851238 8:138647094-138647116 TAGAAAAAGTGCAAGGTGGGGGG - Intronic
1049089179 8:140501286-140501308 TTGAAAAAGAACAAAGCTGGAGG + Intergenic
1049179485 8:141214637-141214659 TTGAAGAAGAACAAAGTTGAGGG + Intronic
1049840816 8:144770410-144770432 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1050007943 9:1153957-1153979 TTCAACAAGAACAAAGTAGGAGG + Intergenic
1050435662 9:5607228-5607250 TTGGAGAAGAACAAGGTAGGAGG + Intergenic
1050809284 9:9723469-9723491 TTAAAAAAGAACAAAGTAGGAGG - Intronic
1051116414 9:13698955-13698977 TTGAAGAAGAACAAAGTAAGAGG - Intergenic
1051369202 9:16343963-16343985 TGGAAAGAGAACAAGGTTGGGGG - Intergenic
1051866323 9:21687292-21687314 TTGAACAAAATCAAGTTGGGAGG + Intergenic
1052183409 9:25560609-25560631 TTGATCAAGAACAAAGCTGGAGG + Intergenic
1052509132 9:29391635-29391657 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1052939376 9:34120372-34120394 TTGAAAAACAACAAAGTGGCTGG + Intronic
1053263376 9:36691477-36691499 TTGAAAAGGAACAAAGTTGGAGG + Intergenic
1055888045 9:81088575-81088597 TTGAAATAGAACAAAGTTGGAGG - Intergenic
1055903164 9:81264191-81264213 TTTAAAAATAACGAGGTGGGTGG + Intergenic
1056000524 9:82211506-82211528 TTGAAAAAGAACAAAATTGGAGG + Intergenic
1056023999 9:82473142-82473164 TTGAAGAAGAACAAACTGGCAGG + Intergenic
1056094504 9:83238732-83238754 TTGAAAAAGAACAAAGTTGAAGG - Intergenic
1056125242 9:83530297-83530319 TTCAACAAGAAAAAGGAAGGAGG + Intronic
1056163090 9:83917513-83917535 TTGAAAAAGAACAAAGTAAGAGG + Intronic
1057104227 9:92396290-92396312 TTGAAGAAGAACAAAGTTGCAGG - Intronic
1057333247 9:94136016-94136038 TTGAAAAAGAACAAAATTGGAGG + Intergenic
1057500251 9:95591451-95591473 CTGAAAAAGAACAAAGTTGGAGG + Intergenic
1057897396 9:98920352-98920374 TTGAAAAACAACAAAGTTGGAGG + Intergenic
1058575012 9:106391649-106391671 TTGAAGCAGAAAGAGGTGGGTGG + Intergenic
1059611836 9:115906360-115906382 TTGAGCAAGAACAAAGCTGGTGG - Intergenic
1060162587 9:121379057-121379079 TTGAAGAAGCACAAAGTTGGAGG + Intergenic
1060500740 9:124152285-124152307 TTGAATAAGGACATGGTGGCTGG - Intergenic
1061588448 9:131583376-131583398 TTGAACAAGAAGACCCTGGGTGG + Intronic
1061815701 9:133193732-133193754 TTGAATAAGAACAAATTTGGAGG + Intergenic
1062190685 9:135246421-135246443 GAGGACAAGAACTAGGTGGGAGG + Intergenic
1186195125 X:7103122-7103144 TTGAAAAAGAACAAAATCGGAGG + Intronic
1186678783 X:11849470-11849492 TTGAAAAAGAAAAAAGTTGGGGG + Intergenic
1187141012 X:16593663-16593685 TTGAACAAAAACAGCGTAGGTGG + Intronic
1187348800 X:18492881-18492903 TTGAACAAGAATAGGAGGGGTGG - Intronic
1187460251 X:19480335-19480357 TTGAAAAAGAACAAAGTTAGAGG + Intronic
1187671463 X:21670074-21670096 TTGAAGAAGAAGAATGTTGGAGG - Intergenic
1187910600 X:24107772-24107794 TTGAAAAAGATCAAAGTTGGAGG - Intergenic
1188079668 X:25821644-25821666 TTGAGAAAGAACAAAGTTGGAGG + Intergenic
1188355302 X:29183367-29183389 TTGAACAATCAAATGGTGGGGGG - Intronic
1188385993 X:29558969-29558991 TTGAGCAAGAACAAACTTGGAGG - Intronic
1189426488 X:40906157-40906179 TTAAAGAAGAATAAAGTGGGAGG + Intergenic
1190140387 X:47837774-47837796 TTGAAAAAGAATAAAGTGAGAGG - Intronic
1190260346 X:48793355-48793377 TAGAACAGGAACAGAGTGGGGGG - Intronic
1190471453 X:50783925-50783947 TTTAAAAAGAACAAAGTTGGAGG + Intronic
1190547115 X:51539483-51539505 TTGAAGAAGAACAAAATTGGAGG - Intergenic
1190668053 X:52713495-52713517 AAGAAGAAGAATAAGGTGGGAGG - Intergenic
1190671364 X:52744909-52744931 AAGAAGAAGAATAAGGTGGGAGG + Intergenic
1190823300 X:53994456-53994478 TTGAATAAGATGAAGGTGGGAGG - Intronic
1190851072 X:54242474-54242496 TTTAAAAAGAACAAAGTTGGAGG + Intronic
1190859987 X:54335837-54335859 TTGAAAAAGAACAAATTTGGAGG + Intronic
1191664485 X:63685519-63685541 TTGAAAAAGAACTAAGTTGGAGG + Intronic
1191709061 X:64129130-64129152 TTGAAAAAGAACACAGTTGGAGG + Intergenic
1192084695 X:68084625-68084647 TTGAAGAAGAACAACCTGTGAGG - Intronic
1192246557 X:69377936-69377958 TTGAAAAAGAATAAAGTTGGAGG + Intergenic
1192295566 X:69844081-69844103 TTGAAGAAGAAAAAAGGGGGTGG + Intronic
1192345980 X:70306291-70306313 TTGAACAAGAACGAAGTTGGAGG - Intronic
1192378089 X:70585557-70585579 TTGAAAAATAACAAAGTTGGAGG + Intronic
1192530733 X:71882074-71882096 ATGAAGAAGAACAAGGTGGGAGG + Intergenic
1192813187 X:74567257-74567279 TTGCAGAAGAATAAAGTGGGAGG + Intergenic
1192872350 X:75195953-75195975 TTGAAAAAGAACAAAGTTGGAGG - Intergenic
1192903781 X:75527486-75527508 TTGAAAAAGAACAATGTTAGAGG - Intergenic
1193302562 X:79907827-79907849 ATGAAAAAGAACAATGTTGGAGG - Intergenic
1193382339 X:80829487-80829509 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1193503671 X:82311495-82311517 TTGAAGAAGATCAAAGTTGGAGG - Intergenic
1193655680 X:84194430-84194452 TTCAACAAGAACAAAGCTGGAGG - Intergenic
1194311115 X:92308202-92308224 TTAAAAAAGAACGAAGTGGGAGG + Intronic
1194565164 X:95477768-95477790 TTGAACAAGAACAAAGTTGGAGG + Intergenic
1194910421 X:99635813-99635835 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1195203209 X:102569271-102569293 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1195303140 X:103551817-103551839 TTGTAAAAGAACAAAGTTGGAGG + Intergenic
1195584344 X:106547399-106547421 TTGAAAAAGAATAAAGTGGGAGG - Intergenic
1195806775 X:108781037-108781059 TTGAAGAAGAACAAAGTTGGAGG - Intergenic
1196605285 X:117650722-117650744 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1196627141 X:117889485-117889507 CTGAGCAAGAACAAGGGAGGAGG - Intergenic
1196703004 X:118692182-118692204 TTGAAAAAGAATAAAGTTGGAGG - Intergenic
1197038943 X:121910941-121910963 TTGAAAAGGAACAAGGTTGGAGG - Intergenic
1197180891 X:123535454-123535476 TTGAGCAAGAACAAAGCTGGAGG - Intergenic
1197472826 X:126883695-126883717 TTGTACAAGAAAAAGGGGGCGGG - Intergenic
1197503402 X:127270486-127270508 TGGAGAAAGAACAAGGAGGGAGG - Intergenic
1197908352 X:131451372-131451394 CTGAAAAAGAACAAGGTTAGAGG - Intergenic
1198195904 X:134361598-134361620 TTGAAAAAGAACAAAGTTGGAGG + Intergenic
1198748644 X:139916811-139916833 TTGAAAAAGAGCAAAGTTGGGGG + Intronic
1198771989 X:140140210-140140232 CTGAAGAAGAACAAAGTTGGAGG + Intergenic
1199346075 X:146742164-146742186 TTGAAAAAGACCAAAGTTGGGGG - Intergenic
1199743100 X:150754261-150754283 CTGAAAAAGAACAAAGTAGGAGG - Intronic
1200204158 X:154303839-154303861 ATGAGCAAGAAGATGGTGGGGGG - Intronic
1200288912 X:154852643-154852665 TTGAAAAAGAACAACGTTGGAGG - Intronic
1200407892 Y:2832329-2832351 TTCAAAAAGAACAAAGTTGGAGG + Intergenic
1200619392 Y:5422492-5422514 TTAAAAAAGAACGAAGTGGGAGG + Intronic
1202585557 Y:26421937-26421959 TTGAACAGAAACAAAATGGGTGG + Intergenic