ID: 1183854749

View in Genome Browser
Species Human (GRCh38)
Location 22:40623903-40623925
Sequence TCTCTTTGTGTTGCCCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2047
Summary {0: 1, 1: 0, 2: 1, 3: 98, 4: 1947}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183854749_1183854751 15 Left 1183854749 22:40623903-40623925 CCACAATGGGCAACACAAAGAGA 0: 1
1: 0
2: 1
3: 98
4: 1947
Right 1183854751 22:40623941-40623963 AAACCTTAAAATTATTAGCTAGG 0: 1
1: 0
2: 9
3: 122
4: 1293
1183854749_1183854754 23 Left 1183854749 22:40623903-40623925 CCACAATGGGCAACACAAAGAGA 0: 1
1: 0
2: 1
3: 98
4: 1947
Right 1183854754 22:40623949-40623971 AAATTATTAGCTAGGTGTGGTGG 0: 2
1: 48
2: 1395
3: 25240
4: 113541
1183854749_1183854753 20 Left 1183854749 22:40623903-40623925 CCACAATGGGCAACACAAAGAGA 0: 1
1: 0
2: 1
3: 98
4: 1947
Right 1183854753 22:40623946-40623968 TTAAAATTATTAGCTAGGTGTGG 0: 1
1: 1
2: 57
3: 792
4: 7262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183854749 Original CRISPR TCTCTTTGTGTTGCCCATTG TGG (reversed) Intronic
Too many off-targets to display for this crispr