ID: 1183856008

View in Genome Browser
Species Human (GRCh38)
Location 22:40635876-40635898
Sequence TACTCCATAGTGCCTAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183856008_1183856016 2 Left 1183856008 22:40635876-40635898 CCAGCCCTAGGCACTATGGAGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1183856016 22:40635901-40635923 AAAGGTACCCGAAGCGGGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 91
1183856008_1183856013 -3 Left 1183856008 22:40635876-40635898 CCAGCCCTAGGCACTATGGAGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1183856013 22:40635896-40635918 GTATCAAAGGTACCCGAAGCGGG 0: 1
1: 0
2: 0
3: 1
4: 39
1183856008_1183856017 5 Left 1183856008 22:40635876-40635898 CCAGCCCTAGGCACTATGGAGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1183856017 22:40635904-40635926 GGTACCCGAAGCGGGGAGGGTGG 0: 1
1: 0
2: 2
3: 13
4: 189
1183856008_1183856014 -2 Left 1183856008 22:40635876-40635898 CCAGCCCTAGGCACTATGGAGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1183856014 22:40635897-40635919 TATCAAAGGTACCCGAAGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 35
1183856008_1183856012 -4 Left 1183856008 22:40635876-40635898 CCAGCCCTAGGCACTATGGAGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1183856012 22:40635895-40635917 AGTATCAAAGGTACCCGAAGCGG 0: 1
1: 0
2: 0
3: 2
4: 56
1183856008_1183856015 1 Left 1183856008 22:40635876-40635898 CCAGCCCTAGGCACTATGGAGTA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1183856015 22:40635900-40635922 CAAAGGTACCCGAAGCGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183856008 Original CRISPR TACTCCATAGTGCCTAGGGC TGG (reversed) Intronic
908706156 1:66957303-66957325 TACACCATGGTGCCTTGGGCAGG - Intronic
912481339 1:109984362-109984384 TAATCCAAAGGGCCTGGGGCTGG + Intergenic
916194149 1:162207981-162208003 TACTCCCCAGTGCCTAGCGCAGG - Intronic
916865165 1:168848664-168848686 GAAGCCATATTGCCTAGGGCAGG - Intergenic
920094066 1:203474452-203474474 TACCCCATATTGCGGAGGGCAGG + Intergenic
920811862 1:209293470-209293492 TACAGCATAGTTCCTAGGACTGG + Intergenic
1069189472 10:65468482-65468504 TAATAAATAGTACCTAGGGCCGG + Intergenic
1071692663 10:87838507-87838529 TACTCCATCTTACCTAGAGCTGG + Intronic
1074673352 10:115820878-115820900 TAATCCCCAGTGTCTAGGGCAGG + Intronic
1075761932 10:124863858-124863880 TACTCCAGAAGCCCTAGGGCTGG - Intergenic
1075906063 10:126083118-126083140 TACTCCATGCTGCCTGGAGCGGG + Intronic
1078967267 11:16360517-16360539 AACTCCATAGTGCCTGTAGCAGG + Intronic
1082731685 11:56805896-56805918 ATCTGCATAGTGCCAAGGGCTGG - Intergenic
1082808855 11:57466561-57466583 TTCTGCATAGTTCCTAGGACTGG + Intronic
1086424908 11:86673388-86673410 CACTCTATAGTTCCTAGTGCAGG - Intergenic
1090259834 11:125311403-125311425 TCCTCCATGGTGTCTAAGGCGGG - Intronic
1100632661 12:96403670-96403692 TATTCCATAGTGCTTAGTGGAGG + Intergenic
1103808538 12:123594000-123594022 TTCTCCATATTGCCCAGGGTTGG + Intronic
1115586096 14:34814669-34814691 TTCTCCACATTGCCCAGGGCTGG + Intronic
1115923705 14:38407411-38407433 TTCTTGATAGTGGCTAGGGCAGG + Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1122987948 14:105221229-105221251 TGCCCCATAGTGCCCAGGCCAGG - Intronic
1125114776 15:36077336-36077358 TAATCCACAGTGCCTATTGCAGG - Intergenic
1125196815 15:37056804-37056826 TGCTCCATTGTGCCCAGGGTGGG - Intronic
1139394122 16:66626406-66626428 TTCGCCATATTGCCTAGGGGTGG - Intronic
1139959243 16:70708288-70708310 TACACCACAAGGCCTAGGGCTGG + Intronic
1143628317 17:8123236-8123258 GACCCCAGATTGCCTAGGGCCGG + Intronic
1146458500 17:33025450-33025472 TGCTCCATTGAGCCTAGGGGAGG - Intronic
1149039711 17:52172986-52173008 TTCTCCACAGTGCCTGAGGCTGG - Intergenic
1152634012 17:81423107-81423129 TGCTCCACAGTCCCTTGGGCCGG + Intronic
1164564012 19:29313018-29313040 TACTTCAGAGGGCCTAGGACTGG + Intergenic
1165699064 19:37923342-37923364 TACTCCATAGCGCCTAGGTGTGG - Intronic
1166785123 19:45362984-45363006 TCCTCCTTAGTGCTCAGGGCAGG + Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
931241285 2:60454504-60454526 TACTCCATTGTCCCTGGGCCTGG - Intronic
933968728 2:87452454-87452476 TACTCCACAGTGTCAAAGGCAGG + Intergenic
937311937 2:120908097-120908119 GACCCCACAGTGCCAAGGGCAGG - Intronic
937813410 2:126223592-126223614 TACACCACAGTCCCTAAGGCAGG + Intergenic
938750763 2:134327550-134327572 TGCTCCATCATGCCCAGGGCTGG - Intronic
938995684 2:136674985-136675007 TGCTCCATAGTGCCTGAGGCTGG + Intergenic
940806603 2:158194552-158194574 ACCTCCAGAGAGCCTAGGGCAGG - Intronic
1169404327 20:5310849-5310871 TTCTCCACAGTGCCTAGCACAGG - Intronic
1172177835 20:32983354-32983376 CACTCCATAGTGGGTAGGGTTGG + Intergenic
1179437665 21:41373498-41373520 AACTCCAAAGGGCCTCGGGCTGG - Intronic
1183856008 22:40635876-40635898 TACTCCATAGTGCCTAGGGCTGG - Intronic
1185037636 22:48488309-48488331 TTCTCCATCCTGCATAGGGCTGG - Intergenic
950002692 3:9669333-9669355 TTCCCCATAGTGCCAAGGGTGGG - Intronic
961644934 3:128387860-128387882 TGCTCCATGCTGCCTGGGGCAGG - Intronic
961782755 3:129330585-129330607 AACTCCATAGAGCCCAGGGAGGG - Intergenic
962805136 3:138921716-138921738 AACTCAGTAGTGGCTAGGGCTGG + Intergenic
974651516 4:64759387-64759409 TACTCCATGCTGCCATGGGCGGG - Intergenic
979190003 4:117845118-117845140 TACTCCTGAGTGCCCAGGTCAGG - Intergenic
979383007 4:120030766-120030788 AACTTCATAGTGTCTAGGACAGG - Intergenic
981807552 4:148734209-148734231 GTCTCCATAGTACCTACGGCAGG + Intergenic
983946530 4:173591937-173591959 TACTCCACAGTGCCTACTACAGG - Intergenic
988520733 5:31943357-31943379 TCTGCCAGAGTGCCTAGGGCAGG - Intronic
995000821 5:107126474-107126496 TTCTTCATAGTGCTTAGGGCTGG + Intergenic
1005959816 6:30686875-30686897 GACCCCAGAGTGCCAAGGGCCGG + Exonic
1007843315 6:44734372-44734394 TATCCCATAGTGCCTAGAACAGG - Intergenic
1008973970 6:57402347-57402369 TACTGCATGGTGCCTAGGTCTGG + Intronic
1009162855 6:60303852-60303874 TACTGCATGGTGCCTAGGTCTGG + Intergenic
1012482406 6:99681690-99681712 CACTCAACACTGCCTAGGGCTGG + Intergenic
1012996739 6:105982300-105982322 TTCTCCATAGTTCGAAGGGCAGG - Intergenic
1032224889 7:130023438-130023460 TTCTCCATGCTGCCTAGGGAGGG + Intronic
1034474521 7:151274970-151274992 GACTCCTTAGTGCCCATGGCAGG - Intronic
1038898951 8:31820177-31820199 TACTCCACAGGAACTAGGGCTGG - Intronic
1045501569 8:102747911-102747933 AGCTCCTTAGGGCCTAGGGCTGG - Intergenic
1046744285 8:117860440-117860462 TACTGCATAGTGGCGAAGGCTGG - Intronic
1047714140 8:127579991-127580013 TATTCCATAGTGCCCAGCACAGG - Intergenic
1047752138 8:127889906-127889928 TGATCCACAATGCCTAGGGCTGG - Intergenic
1053591698 9:39521103-39521125 TGCTCCATAGTGCCTGGGCATGG + Intergenic
1053849546 9:42276466-42276488 TGCTCCATAGTGCCTGGGCATGG + Intergenic
1061077329 9:128349607-128349629 GCCCTCATAGTGCCTAGGGCTGG + Intronic
1188932704 X:36133251-36133273 TACTCCTTAGTACCTAGTGTAGG + Intronic
1192541240 X:71975055-71975077 TGCTCCTTAGTGCCTAAAGCTGG + Intergenic
1195049208 X:101081335-101081357 TACTGCATAGTGCCTGGGCTTGG + Intronic
1197891674 X:131275679-131275701 TACTCTCTGGTGCCGAGGGCCGG - Exonic