ID: 1183856036

View in Genome Browser
Species Human (GRCh38)
Location 22:40636059-40636081
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183856029_1183856036 27 Left 1183856029 22:40636009-40636031 CCTGGCAGCATTCAGGTTTGCTA No data
Right 1183856036 22:40636059-40636081 CTCCTTGCCTGGGAATCCCAAGG No data
1183856031_1183856036 -4 Left 1183856031 22:40636040-40636062 CCAACAAGTCCAGCTGAGCCTCC No data
Right 1183856036 22:40636059-40636081 CTCCTTGCCTGGGAATCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type