ID: 1183856039

View in Genome Browser
Species Human (GRCh38)
Location 22:40636070-40636092
Sequence GGAATCCCAAGGACTGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183856031_1183856039 7 Left 1183856031 22:40636040-40636062 CCAACAAGTCCAGCTGAGCCTCC No data
Right 1183856039 22:40636070-40636092 GGAATCCCAAGGACTGCACTTGG No data
1183856033_1183856039 -2 Left 1183856033 22:40636049-40636071 CCAGCTGAGCCTCCTTGCCTGGG No data
Right 1183856039 22:40636070-40636092 GGAATCCCAAGGACTGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183856039 Original CRISPR GGAATCCCAAGGACTGCACT TGG Intronic