ID: 1183856039 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:40636070-40636092 |
| Sequence | GGAATCCCAAGGACTGCACT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1183856031_1183856039 | 7 | Left | 1183856031 | 22:40636040-40636062 | CCAACAAGTCCAGCTGAGCCTCC | No data | ||
| Right | 1183856039 | 22:40636070-40636092 | GGAATCCCAAGGACTGCACTTGG | No data | ||||
| 1183856033_1183856039 | -2 | Left | 1183856033 | 22:40636049-40636071 | CCAGCTGAGCCTCCTTGCCTGGG | No data | ||
| Right | 1183856039 | 22:40636070-40636092 | GGAATCCCAAGGACTGCACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1183856039 | Original CRISPR | GGAATCCCAAGGACTGCACT TGG | Intronic | ||