ID: 1183856042

View in Genome Browser
Species Human (GRCh38)
Location 22:40636080-40636102
Sequence GGACTGCACTTGGATCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183856031_1183856042 17 Left 1183856031 22:40636040-40636062 CCAACAAGTCCAGCTGAGCCTCC No data
Right 1183856042 22:40636080-40636102 GGACTGCACTTGGATCCTGAAGG No data
1183856033_1183856042 8 Left 1183856033 22:40636049-40636071 CCAGCTGAGCCTCCTTGCCTGGG No data
Right 1183856042 22:40636080-40636102 GGACTGCACTTGGATCCTGAAGG No data
1183856037_1183856042 -4 Left 1183856037 22:40636061-40636083 CCTTGCCTGGGAATCCCAAGGAC No data
Right 1183856042 22:40636080-40636102 GGACTGCACTTGGATCCTGAAGG No data
1183856035_1183856042 -1 Left 1183856035 22:40636058-40636080 CCTCCTTGCCTGGGAATCCCAAG No data
Right 1183856042 22:40636080-40636102 GGACTGCACTTGGATCCTGAAGG No data
1183856038_1183856042 -9 Left 1183856038 22:40636066-40636088 CCTGGGAATCCCAAGGACTGCAC No data
Right 1183856042 22:40636080-40636102 GGACTGCACTTGGATCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183856042 Original CRISPR GGACTGCACTTGGATCCTGA AGG Intronic