ID: 1183856205

View in Genome Browser
Species Human (GRCh38)
Location 22:40636668-40636690
Sequence ACCACAGACACTGCCGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183856201_1183856205 0 Left 1183856201 22:40636645-40636667 CCGTCGCTCTCGCCGCCGCGGCC 0: 1
1: 0
2: 2
3: 42
4: 432
Right 1183856205 22:40636668-40636690 ACCACAGACACTGCCGCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 88
1183856199_1183856205 23 Left 1183856199 22:40636622-40636644 CCAAGAGGGTGGGAAAGATGGGA 0: 1
1: 0
2: 3
3: 39
4: 321
Right 1183856205 22:40636668-40636690 ACCACAGACACTGCCGCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183856205 Original CRISPR ACCACAGACACTGCCGCCGC CGG Exonic
906489697 1:46258858-46258880 ACCCCAAACACAGCCACCGCTGG - Intronic
917976136 1:180239859-180239881 TTCACAGACACAGCCGCCCCTGG + Intronic
1070218949 10:74420024-74420046 ACCCCAGACACTGCCACCAGGGG + Intronic
1070862148 10:79679611-79679633 ACAACAGACACTGGGGCCTCTGG - Intergenic
1070874989 10:79794845-79794867 ACAACAGACACTGGGGCCTCTGG + Intergenic
1071641913 10:87317010-87317032 ACAACAGACACTGGGGCCTCTGG + Intergenic
1077919239 11:6630787-6630809 ACGACAGGCACTGGTGCCGCTGG + Exonic
1079625957 11:22618052-22618074 CCCACAGCCACTGCCACCCCAGG + Intergenic
1081206029 11:40276792-40276814 GACACAGACACTGCAGCAGCAGG - Intronic
1084944713 11:72632422-72632444 ACCACAGTCACTGCCGGAGATGG - Intronic
1096220130 12:49823952-49823974 ACTACAGACACAGGCGCCGAGGG + Intronic
1096256594 12:50065638-50065660 AGGACAGACACTGCCACCCCAGG + Intronic
1096541231 12:52308416-52308438 GCCACAGACAACGCCACCGCGGG - Exonic
1096574580 12:52544706-52544728 GCCATAGACACTGCCGCCACTGG + Exonic
1098367382 12:69719066-69719088 ACCACAGACACACCTGCCCCAGG + Intergenic
1098476483 12:70909844-70909866 ACCAGAGGCACTGCCACCACGGG - Intronic
1101874758 12:108590811-108590833 ACCACACACACTTCTGCTGCTGG + Exonic
1110363137 13:74650560-74650582 ACAACAGAGACTGCAGCAGCTGG - Intergenic
1110450813 13:75636180-75636202 ACCACAGAGGCGGCCGCGGCCGG + Intronic
1113792177 13:113034751-113034773 AGCACAGACACTGCAACCCCGGG - Intronic
1116659408 14:47689464-47689486 ACCACTGCCACTGCTGCCACCGG - Intergenic
1117555604 14:56880034-56880056 ACTACAGACACTCCTGCCTCAGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1124251452 15:28108766-28108788 AGCAGAGACACAGCCCCCGCAGG + Intergenic
1129750358 15:78058669-78058691 ACCAAAGACACGCCCGCCGGAGG + Intronic
1132351323 15:101141464-101141486 ACCACAGGCCCTGCTGCTGCTGG + Intergenic
1136784286 16:32925525-32925547 CCCACAGCCCCCGCCGCCGCCGG - Intergenic
1136885498 16:33928281-33928303 CCCACAGCCCCCGCCGCCGCCGG + Intergenic
1138968354 16:62113608-62113630 ACCACAGACACTGACACTGATGG + Intergenic
1139648809 16:68351507-68351529 ACCACCCCCACTGCCGCCTCCGG + Intronic
1140607800 16:76562402-76562424 ACCACAGACCCTACCACTGCAGG + Intronic
1203086943 16_KI270728v1_random:1189531-1189553 CCCACAGCCCCCGCCGCCGCCGG - Intergenic
1147159882 17:38563613-38563635 GCCTCAGACCCTGCCGCTGCGGG - Intronic
1155736347 18:29227087-29227109 AACACAGACACTTCCTCTGCTGG + Intergenic
1157006624 18:43590435-43590457 ACCTCACCCACTGCCGCTGCAGG - Intergenic
1158435991 18:57435823-57435845 GCCCCCGCCACTGCCGCCGCCGG - Exonic
1161117313 19:2505020-2505042 ACAACACACACTGGGGCCGCTGG - Intergenic
1162931621 19:13960458-13960480 GCTCCAGACACTGCCGCTGCGGG - Exonic
1162954324 19:14090033-14090055 GCCGCAGCCACAGCCGCCGCCGG - Exonic
1163154473 19:15432491-15432513 GCCACCGCCACCGCCGCCGCGGG - Intronic
1166784057 19:45357356-45357378 GCCACAGACACTGTCCCCGCTGG - Exonic
930004861 2:46888653-46888675 CCCACACTCACTGCCGCCCCTGG + Intergenic
931493065 2:62770980-62771002 ACAACAGACACTGCGGCCTATGG + Intronic
938612941 2:132968047-132968069 ACCACAGACCCTCCCTCAGCTGG - Intronic
944273087 2:197804958-197804980 GCCGCCGCCACTGCCGCCGCTGG + Exonic
948488363 2:238295626-238295648 CCCACAATCACTGCCGTCGCAGG - Intergenic
1171977591 20:31605406-31605428 AGCACCGCCACCGCCGCCGCGGG + Exonic
1175882715 20:62270135-62270157 ACCACAGGCACTGCATGCGCAGG - Intronic
1176429164 21:6565288-6565310 AACACAGACACTGACACCACCGG + Intergenic
1178408836 21:32347508-32347530 ACCAAAGACCCCGCCGCAGCTGG - Exonic
1178495212 21:33080545-33080567 TCCACAGACATTGCCTCTGCTGG + Intergenic
1181413129 22:22738926-22738948 TCCACAGACACTGCTGGCTCTGG - Intronic
1182423996 22:30262646-30262668 ACCACAGTCACAGCCCCCGGCGG + Intergenic
1183442817 22:37832873-37832895 ACCACAGACACACCTGCCTCTGG - Intronic
1183856205 22:40636668-40636690 ACCACAGACACTGCCGCCGCCGG + Exonic
1184660797 22:45964666-45964688 ACCACAGGCTCTGCCACCCCTGG + Intronic
1185155493 22:49191279-49191301 ACCTCAGACTCTGCAGACGCGGG + Intergenic
951409360 3:22343518-22343540 GCCACGGACACTGCTGCCACTGG - Intronic
954325228 3:49859778-49859800 GCCACAGACACTGCCACCCCCGG - Exonic
956738576 3:72257836-72257858 AACACAGACACTGTCTCAGCTGG + Intergenic
961433119 3:126897184-126897206 CCCACAGACACTGCTGCAGCAGG + Intronic
961659633 3:128461904-128461926 ACCACACACCCTGCAGCCCCAGG - Intergenic
968596555 4:1489056-1489078 CCCACAGACACTGGAGCCCCAGG - Intergenic
975095603 4:70453397-70453419 CCCACAGCCACTGCCACCACAGG + Intronic
991024014 5:62010527-62010549 ACCACAGTCACTGCTGATGCAGG + Intergenic
996366092 5:122702969-122702991 TCCACACACACTGCAGCAGCAGG + Intergenic
1005992862 6:30914293-30914315 TCCTCAGTCCCTGCCGCCGCGGG + Intronic
1006233494 6:32606363-32606385 ACCACAAACACTGAAGCCCCTGG - Intergenic
1007139075 6:39553828-39553850 GCCACAGGCACTGCTGCCCCTGG + Intronic
1007566114 6:42851810-42851832 ACCACAAACACAGCAGCCCCGGG + Intronic
1009004346 6:57764364-57764386 ATCCCAGACACTGCAGGCGCTGG + Intergenic
1013111805 6:107070315-107070337 GCCACAGGCACTGCAGCCCCGGG + Exonic
1013207797 6:107959663-107959685 ACCCCAGCCACAGCTGCCGCTGG - Intergenic
1015954723 6:138587839-138587861 ACAACAGACACTGCCTCCCACGG + Intronic
1016738970 6:147508626-147508648 GCCGCCGACGCTGCCGCCGCGGG - Intergenic
1017409201 6:154150998-154151020 ACCAGAGACACTGCCCCAGCTGG + Intronic
1022423866 7:30248961-30248983 ACCACAGGCTCTGCCTCAGCTGG - Intergenic
1022714990 7:32891373-32891395 ACCCGAGACGCTTCCGCCGCGGG - Intronic
1029988165 7:104940300-104940322 AGCACACACGCTGCAGCCGCTGG - Intergenic
1029993042 7:104979512-104979534 ACCACAGGCACTGCCTTGGCGGG - Intergenic
1036074282 8:5477510-5477532 CCCACAGCCACTGCCACCACAGG + Intergenic
1039928042 8:41957048-41957070 ACAACAGACAGTGCCGCAGCAGG - Intronic
1047214516 8:122865552-122865574 ACCACAGACATTGCCTCCCTGGG - Intronic
1049608282 8:143540021-143540043 ACCACAGGCCCTGCCCCCGGGGG + Intronic
1049662159 8:143824344-143824366 ACCACTGCCGCCGCCGCCGCCGG + Exonic
1049804004 8:144530760-144530782 ACCACGGCCACCGCCGCCTCGGG + Exonic
1050270808 9:3942696-3942718 AACACAGACTCTGCCTCAGCAGG + Intronic
1050676591 9:8062746-8062768 TCCACAGCCACTGCTGCTGCTGG - Intergenic
1052319722 9:27154996-27155018 ACCACGGCCACTGCCACCGCTGG + Intronic
1060765551 9:126293155-126293177 ACCACAGACACAGACGTGGCTGG - Intergenic
1061371596 9:130200695-130200717 GCCACTGCCACTGCCGCTGCTGG - Intronic
1186464739 X:9776163-9776185 ATCACAGACAATGTCTCCGCAGG - Intronic
1190337031 X:49269022-49269044 ACCACCTACACTGCCCCCGTCGG + Intergenic
1192361754 X:70445113-70445135 ACCACCGCCGCCGCCGCCGCCGG - Exonic
1192659667 X:73029266-73029288 CCCACAGACACTGCCACTGCTGG + Intergenic
1196865406 X:120066344-120066366 TCCACAGCCACTGCCACCCCTGG - Intergenic
1200056745 X:153465554-153465576 ACCACAGACTCTGTTGCGGCAGG - Intronic