ID: 1183857170

View in Genome Browser
Species Human (GRCh38)
Location 22:40642663-40642685
Sequence TTGCATGTGTATATGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183857164_1183857170 29 Left 1183857164 22:40642611-40642633 CCTGTGGCCTTCCTCGGTCTGAC No data
Right 1183857170 22:40642663-40642685 TTGCATGTGTATATGGAGACAGG No data
1183857165_1183857170 22 Left 1183857165 22:40642618-40642640 CCTTCCTCGGTCTGACTCCCTAC No data
Right 1183857170 22:40642663-40642685 TTGCATGTGTATATGGAGACAGG No data
1183857168_1183857170 4 Left 1183857168 22:40642636-40642658 CCTACGTCTACTATTAAACTATA No data
Right 1183857170 22:40642663-40642685 TTGCATGTGTATATGGAGACAGG No data
1183857167_1183857170 5 Left 1183857167 22:40642635-40642657 CCCTACGTCTACTATTAAACTAT No data
Right 1183857170 22:40642663-40642685 TTGCATGTGTATATGGAGACAGG No data
1183857166_1183857170 18 Left 1183857166 22:40642622-40642644 CCTCGGTCTGACTCCCTACGTCT No data
Right 1183857170 22:40642663-40642685 TTGCATGTGTATATGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183857170 Original CRISPR TTGCATGTGTATATGGAGAC AGG Intergenic
No off target data available for this crispr