ID: 1183858927

View in Genome Browser
Species Human (GRCh38)
Location 22:40654997-40655019
Sequence CTTGCTGCTGACCATTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183858927_1183858931 1 Left 1183858927 22:40654997-40655019 CCTGCCAAATGGTCAGCAGCAAG No data
Right 1183858931 22:40655021-40655043 TGTAACTGGATGTCGCTTCCAGG No data
1183858927_1183858934 30 Left 1183858927 22:40654997-40655019 CCTGCCAAATGGTCAGCAGCAAG No data
Right 1183858934 22:40655050-40655072 AGTGAAAAGAGACAAGGAGTAGG No data
1183858927_1183858933 24 Left 1183858927 22:40654997-40655019 CCTGCCAAATGGTCAGCAGCAAG No data
Right 1183858933 22:40655044-40655066 AAGCAGAGTGAAAAGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183858927 Original CRISPR CTTGCTGCTGACCATTTGGC AGG (reversed) Intergenic
No off target data available for this crispr