ID: 1183859736

View in Genome Browser
Species Human (GRCh38)
Location 22:40661257-40661279
Sequence CTTCCAGGACTTCTGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183859736_1183859740 6 Left 1183859736 22:40661257-40661279 CCTTGTTCCAGAAGTCCTGGAAG No data
Right 1183859740 22:40661286-40661308 AAGCTGGATACCTGCAAGAAAGG No data
1183859736_1183859742 29 Left 1183859736 22:40661257-40661279 CCTTGTTCCAGAAGTCCTGGAAG No data
Right 1183859742 22:40661309-40661331 ACCCTGCAATTCCACAAGTACGG No data
1183859736_1183859744 30 Left 1183859736 22:40661257-40661279 CCTTGTTCCAGAAGTCCTGGAAG No data
Right 1183859744 22:40661310-40661332 CCCTGCAATTCCACAAGTACGGG No data
1183859736_1183859738 -10 Left 1183859736 22:40661257-40661279 CCTTGTTCCAGAAGTCCTGGAAG No data
Right 1183859738 22:40661270-40661292 GTCCTGGAAGAAGTAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183859736 Original CRISPR CTTCCAGGACTTCTGGAACA AGG (reversed) Intergenic
No off target data available for this crispr