ID: 1183859738

View in Genome Browser
Species Human (GRCh38)
Location 22:40661270-40661292
Sequence GTCCTGGAAGAAGTAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183859733_1183859738 1 Left 1183859733 22:40661246-40661268 CCTGAGTCAGCCCTTGTTCCAGA No data
Right 1183859738 22:40661270-40661292 GTCCTGGAAGAAGTAAAAGCTGG No data
1183859731_1183859738 13 Left 1183859731 22:40661234-40661256 CCAATTTCCAAACCTGAGTCAGC No data
Right 1183859738 22:40661270-40661292 GTCCTGGAAGAAGTAAAAGCTGG No data
1183859736_1183859738 -10 Left 1183859736 22:40661257-40661279 CCTTGTTCCAGAAGTCCTGGAAG No data
Right 1183859738 22:40661270-40661292 GTCCTGGAAGAAGTAAAAGCTGG No data
1183859732_1183859738 6 Left 1183859732 22:40661241-40661263 CCAAACCTGAGTCAGCCCTTGTT No data
Right 1183859738 22:40661270-40661292 GTCCTGGAAGAAGTAAAAGCTGG No data
1183859735_1183859738 -9 Left 1183859735 22:40661256-40661278 CCCTTGTTCCAGAAGTCCTGGAA No data
Right 1183859738 22:40661270-40661292 GTCCTGGAAGAAGTAAAAGCTGG No data
1183859730_1183859738 14 Left 1183859730 22:40661233-40661255 CCCAATTTCCAAACCTGAGTCAG No data
Right 1183859738 22:40661270-40661292 GTCCTGGAAGAAGTAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183859738 Original CRISPR GTCCTGGAAGAAGTAAAAGC TGG Intergenic
No off target data available for this crispr