ID: 1183859739

View in Genome Browser
Species Human (GRCh38)
Location 22:40661272-40661294
Sequence ATCCAGCTTTTACTTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183859739_1183859740 -9 Left 1183859739 22:40661272-40661294 CCTGGAAGAAGTAAAAGCTGGAT No data
Right 1183859740 22:40661286-40661308 AAGCTGGATACCTGCAAGAAAGG No data
1183859739_1183859744 15 Left 1183859739 22:40661272-40661294 CCTGGAAGAAGTAAAAGCTGGAT No data
Right 1183859744 22:40661310-40661332 CCCTGCAATTCCACAAGTACGGG No data
1183859739_1183859746 19 Left 1183859739 22:40661272-40661294 CCTGGAAGAAGTAAAAGCTGGAT No data
Right 1183859746 22:40661314-40661336 GCAATTCCACAAGTACGGGCTGG No data
1183859739_1183859742 14 Left 1183859739 22:40661272-40661294 CCTGGAAGAAGTAAAAGCTGGAT No data
Right 1183859742 22:40661309-40661331 ACCCTGCAATTCCACAAGTACGG No data
1183859739_1183859747 20 Left 1183859739 22:40661272-40661294 CCTGGAAGAAGTAAAAGCTGGAT No data
Right 1183859747 22:40661315-40661337 CAATTCCACAAGTACGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183859739 Original CRISPR ATCCAGCTTTTACTTCTTCC AGG (reversed) Intergenic
No off target data available for this crispr