ID: 1183859740

View in Genome Browser
Species Human (GRCh38)
Location 22:40661286-40661308
Sequence AAGCTGGATACCTGCAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183859735_1183859740 7 Left 1183859735 22:40661256-40661278 CCCTTGTTCCAGAAGTCCTGGAA No data
Right 1183859740 22:40661286-40661308 AAGCTGGATACCTGCAAGAAAGG No data
1183859739_1183859740 -9 Left 1183859739 22:40661272-40661294 CCTGGAAGAAGTAAAAGCTGGAT No data
Right 1183859740 22:40661286-40661308 AAGCTGGATACCTGCAAGAAAGG No data
1183859736_1183859740 6 Left 1183859736 22:40661257-40661279 CCTTGTTCCAGAAGTCCTGGAAG No data
Right 1183859740 22:40661286-40661308 AAGCTGGATACCTGCAAGAAAGG No data
1183859730_1183859740 30 Left 1183859730 22:40661233-40661255 CCCAATTTCCAAACCTGAGTCAG No data
Right 1183859740 22:40661286-40661308 AAGCTGGATACCTGCAAGAAAGG No data
1183859737_1183859740 -1 Left 1183859737 22:40661264-40661286 CCAGAAGTCCTGGAAGAAGTAAA No data
Right 1183859740 22:40661286-40661308 AAGCTGGATACCTGCAAGAAAGG No data
1183859733_1183859740 17 Left 1183859733 22:40661246-40661268 CCTGAGTCAGCCCTTGTTCCAGA No data
Right 1183859740 22:40661286-40661308 AAGCTGGATACCTGCAAGAAAGG No data
1183859731_1183859740 29 Left 1183859731 22:40661234-40661256 CCAATTTCCAAACCTGAGTCAGC No data
Right 1183859740 22:40661286-40661308 AAGCTGGATACCTGCAAGAAAGG No data
1183859732_1183859740 22 Left 1183859732 22:40661241-40661263 CCAAACCTGAGTCAGCCCTTGTT No data
Right 1183859740 22:40661286-40661308 AAGCTGGATACCTGCAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183859740 Original CRISPR AAGCTGGATACCTGCAAGAA AGG Intergenic
No off target data available for this crispr