ID: 1183859741

View in Genome Browser
Species Human (GRCh38)
Location 22:40661296-40661318
Sequence ATTGCAGGGTCCTTTCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183859741_1183859742 -10 Left 1183859741 22:40661296-40661318 CCTGCAAGAAAGGACCCTGCAAT No data
Right 1183859742 22:40661309-40661331 ACCCTGCAATTCCACAAGTACGG No data
1183859741_1183859749 20 Left 1183859741 22:40661296-40661318 CCTGCAAGAAAGGACCCTGCAAT No data
Right 1183859749 22:40661339-40661361 ATCTGCCTCTAGCCTTCCCCAGG No data
1183859741_1183859747 -4 Left 1183859741 22:40661296-40661318 CCTGCAAGAAAGGACCCTGCAAT No data
Right 1183859747 22:40661315-40661337 CAATTCCACAAGTACGGGCTGGG No data
1183859741_1183859744 -9 Left 1183859741 22:40661296-40661318 CCTGCAAGAAAGGACCCTGCAAT No data
Right 1183859744 22:40661310-40661332 CCCTGCAATTCCACAAGTACGGG No data
1183859741_1183859746 -5 Left 1183859741 22:40661296-40661318 CCTGCAAGAAAGGACCCTGCAAT No data
Right 1183859746 22:40661314-40661336 GCAATTCCACAAGTACGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183859741 Original CRISPR ATTGCAGGGTCCTTTCTTGC AGG (reversed) Intergenic
No off target data available for this crispr