ID: 1183859742

View in Genome Browser
Species Human (GRCh38)
Location 22:40661309-40661331
Sequence ACCCTGCAATTCCACAAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183859739_1183859742 14 Left 1183859739 22:40661272-40661294 CCTGGAAGAAGTAAAAGCTGGAT No data
Right 1183859742 22:40661309-40661331 ACCCTGCAATTCCACAAGTACGG No data
1183859737_1183859742 22 Left 1183859737 22:40661264-40661286 CCAGAAGTCCTGGAAGAAGTAAA No data
Right 1183859742 22:40661309-40661331 ACCCTGCAATTCCACAAGTACGG No data
1183859736_1183859742 29 Left 1183859736 22:40661257-40661279 CCTTGTTCCAGAAGTCCTGGAAG No data
Right 1183859742 22:40661309-40661331 ACCCTGCAATTCCACAAGTACGG No data
1183859741_1183859742 -10 Left 1183859741 22:40661296-40661318 CCTGCAAGAAAGGACCCTGCAAT No data
Right 1183859742 22:40661309-40661331 ACCCTGCAATTCCACAAGTACGG No data
1183859735_1183859742 30 Left 1183859735 22:40661256-40661278 CCCTTGTTCCAGAAGTCCTGGAA No data
Right 1183859742 22:40661309-40661331 ACCCTGCAATTCCACAAGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183859742 Original CRISPR ACCCTGCAATTCCACAAGTA CGG Intergenic
No off target data available for this crispr