ID: 1183859747

View in Genome Browser
Species Human (GRCh38)
Location 22:40661315-40661337
Sequence CAATTCCACAAGTACGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183859739_1183859747 20 Left 1183859739 22:40661272-40661294 CCTGGAAGAAGTAAAAGCTGGAT No data
Right 1183859747 22:40661315-40661337 CAATTCCACAAGTACGGGCTGGG No data
1183859737_1183859747 28 Left 1183859737 22:40661264-40661286 CCAGAAGTCCTGGAAGAAGTAAA No data
Right 1183859747 22:40661315-40661337 CAATTCCACAAGTACGGGCTGGG No data
1183859741_1183859747 -4 Left 1183859741 22:40661296-40661318 CCTGCAAGAAAGGACCCTGCAAT No data
Right 1183859747 22:40661315-40661337 CAATTCCACAAGTACGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183859747 Original CRISPR CAATTCCACAAGTACGGGCT GGG Intergenic
No off target data available for this crispr