ID: 1183860956

View in Genome Browser
Species Human (GRCh38)
Location 22:40669550-40669572
Sequence CCTGTACCTGGACTTTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183860951_1183860956 2 Left 1183860951 22:40669525-40669547 CCGTGAGGTCACAGCTGTATCTG No data
Right 1183860956 22:40669550-40669572 CCTGTACCTGGACTTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183860956 Original CRISPR CCTGTACCTGGACTTTGTTG GGG Intergenic
No off target data available for this crispr