ID: 1183862614

View in Genome Browser
Species Human (GRCh38)
Location 22:40680730-40680752
Sequence CTTCCAAGACAGATGGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183862608_1183862614 12 Left 1183862608 22:40680695-40680717 CCTCTGGTGCCTGCAGGAGGCAG 0: 1
1: 1
2: 3
3: 54
4: 493
Right 1183862614 22:40680730-40680752 CTTCCAAGACAGATGGCTCAGGG 0: 1
1: 0
2: 0
3: 21
4: 145
1183862610_1183862614 3 Left 1183862610 22:40680704-40680726 CCTGCAGGAGGCAGGCATGTTGT 0: 1
1: 0
2: 0
3: 15
4: 198
Right 1183862614 22:40680730-40680752 CTTCCAAGACAGATGGCTCAGGG 0: 1
1: 0
2: 0
3: 21
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183862614 Original CRISPR CTTCCAAGACAGATGGCTCA GGG Intronic
901636946 1:10674909-10674931 CTGCCACGACAGAGGGCCCAGGG - Intronic
901733441 1:11296882-11296904 CTACCAAGGCAGAGGGCCCATGG + Intergenic
902397295 1:16139254-16139276 CTGCCCAGACACAGGGCTCACGG + Intronic
903644233 1:24883397-24883419 CTTCCAAAACAGAAGGCACCAGG - Intergenic
908574817 1:65448647-65448669 CTTCCAAAACAGAAAGCACAAGG - Intronic
912456896 1:109803996-109804018 CTTCCAGGACACCTGTCTCAAGG - Intergenic
912496123 1:110092995-110093017 CATCCATGACATATGGCTCCTGG + Intergenic
915913310 1:159927607-159927629 CTTCCAGTACAGATGGCCCAAGG + Intronic
916247294 1:162701414-162701436 CTTACAAGCCATATGGCTCTTGG + Intronic
917460809 1:175227523-175227545 CAGCCAGGATAGATGGCTCAAGG + Intergenic
917612640 1:176704060-176704082 CTTCCAAGGCAGCTGTCTGATGG + Intronic
920135410 1:203765308-203765330 CTTCCAAGTGAGGTGGCTCAGGG - Exonic
922021364 1:221708157-221708179 CCTCAAAGACAGATGGCTTGTGG + Intronic
922171882 1:223162387-223162409 CTTCCAAGACAGAAAGTCCAAGG - Intergenic
922521865 1:226260198-226260220 CTTCCAAAACAGATAGCACCAGG + Intronic
923420519 1:233810433-233810455 GATCCAAACCAGATGGCTCATGG + Intergenic
924342408 1:243050040-243050062 CTTTCAGGGCAGATGGCTCCAGG - Intergenic
1062907985 10:1191549-1191571 GTTCCATTACAGACGGCTCAGGG - Intronic
1066124856 10:32331019-32331041 ATTCCAAGACAAATGAATCAAGG + Intronic
1067278263 10:44853007-44853029 CCTCCAAGGCTGAAGGCTCAAGG - Intergenic
1067702601 10:48584469-48584491 CTACCAGGACAGGTGGCCCATGG + Intronic
1068228464 10:54137895-54137917 CTTCTAAGACTCTTGGCTCAAGG - Intronic
1072662327 10:97370591-97370613 CTTCCCGGGCAGATGGCTCAGGG - Intronic
1073732276 10:106303518-106303540 CTTGCAAGACAGCTGTTTCATGG + Intergenic
1075246896 10:120830588-120830610 CTACTACGACACATGGCTCATGG - Intergenic
1076684751 10:132193204-132193226 CTTCCGAGGCATGTGGCTCAAGG - Intronic
1077496614 11:2889780-2889802 GTTTGAAGACAGATAGCTCAGGG - Intronic
1077523116 11:3048002-3048024 CTGCAAAGACAGAGGGCACATGG + Intronic
1077556802 11:3229929-3229951 CTCCCAAGGCAGTCGGCTCACGG + Intronic
1078968945 11:16383308-16383330 AATCCAAAACAGATGTCTCAAGG + Intronic
1079036225 11:17022470-17022492 GTTACAAGGCAGAAGGCTCATGG - Intergenic
1080605013 11:33858153-33858175 TTTCCAAGACGGGTGTCTCAGGG - Intergenic
1081897341 11:46597848-46597870 CTTCCTAGTAAGATGACTCACGG - Intergenic
1084914169 11:72415465-72415487 CTTCCAAGAGAGAAGGTTCTAGG - Intronic
1085245285 11:75096244-75096266 ATTCGAAGACAGATGTGTCATGG + Intergenic
1085537241 11:77229484-77229506 CTCCCAAGACAGAGGGCAGAGGG + Intronic
1085624656 11:78062699-78062721 CTTCCAAGACTGCTGGTCCAAGG + Intronic
1085701271 11:78747991-78748013 CTTCCAGCACAGAGGGCTGATGG + Intronic
1089126936 11:116183100-116183122 CTTACAAAACAGATGGGTCTGGG + Intergenic
1092555102 12:9550712-9550734 CTTCCAAAAAACATGGCTAAGGG - Intergenic
1093423947 12:19006733-19006755 CTTGCAAGACAGATGTTTGAGGG - Intergenic
1094516994 12:31139962-31139984 CTTCCAAAAAACATGGCTAAGGG + Intergenic
1097353959 12:58580285-58580307 ATTTCAGGACAGATGACTCATGG + Intronic
1101395042 12:104339421-104339443 CTTTCAATACTGATTGCTCATGG + Intronic
1102407138 12:112683395-112683417 CCTACCAAACAGATGGCTCATGG + Intronic
1102419164 12:112790461-112790483 CTTCCCATCCAGATGGCCCAGGG - Intronic
1102545919 12:113655409-113655431 CTACCAGGACACCTGGCTCACGG + Intergenic
1105627304 13:22125345-22125367 CTTATAAGACACATGGCTGAGGG - Intergenic
1107410482 13:40153432-40153454 AGTCCCAGGCAGATGGCTCATGG + Intergenic
1109850933 13:68062162-68062184 CATCCAAGACAGCTTGCTAAGGG + Intergenic
1111607638 13:90561571-90561593 CTTCCAAGACAGCAGGCCCTTGG + Intergenic
1112525697 13:100144852-100144874 TTTGCAAGAGAGATGGCTGATGG + Intronic
1113122819 13:106942515-106942537 CTTCCAAGGCTGATGGCCCTTGG + Intergenic
1114644659 14:24248507-24248529 CTTTCAAGACAAAGGGCTCATGG - Intergenic
1119978716 14:79055222-79055244 ATGCCAAGACAGGTGGATCATGG + Intronic
1124089258 15:26582415-26582437 CTTAGAGGACAGAAGGCTCAGGG - Intronic
1125259320 15:37804380-37804402 CTTCCAACACATATGGCCAAAGG + Intergenic
1131526165 15:93154413-93154435 CTTCCAAAACAGAGGGCACAAGG - Intergenic
1132207963 15:99999466-99999488 CTTCCAAGGCAGAGGTCACAGGG + Intronic
1135908348 16:26535981-26536003 CTTCCAACACAGAAGTCTCCAGG - Intergenic
1137022502 16:35442526-35442548 CTCCCAACACTGATGGTTCATGG + Intergenic
1138410552 16:56836190-56836212 TTTCTAAGACAGATGGCAAAAGG - Intronic
1138592220 16:58007340-58007362 CTTCCAAAACAGAAGGCACCAGG - Intronic
1140198574 16:72876268-72876290 CTTCAGCCACAGATGGCTCAGGG + Intronic
1140641978 16:76985632-76985654 CTTCCAAGACTTCTGGCTCCTGG + Intergenic
1140725138 16:77805060-77805082 CTTCCCACACTGCTGGCTCATGG - Intronic
1144652608 17:17016976-17016998 CTTCCTAGCCAGCTCGCTCAGGG + Intergenic
1144759910 17:17701308-17701330 CTGCCTAGGCAGAAGGCTCAGGG - Intronic
1145795321 17:27652109-27652131 TTGGGAAGACAGATGGCTCATGG - Intergenic
1153199561 18:2634597-2634619 CTCCCAAGTCAGAGGTCTCAAGG - Intergenic
1154004609 18:10516335-10516357 CTTCTCTGACTGATGGCTCATGG - Intergenic
1155234580 18:23806470-23806492 CTTCCATGACAGCTGCCTCAGGG + Intronic
1156482094 18:37442754-37442776 ATTCCCATACAGGTGGCTCAGGG - Intronic
1157679707 18:49595137-49595159 CTTACATGGCAGAGGGCTCAGGG - Exonic
1157802154 18:50629652-50629674 CCTCAAAGACGGATGGCCCATGG - Intronic
1158063754 18:53379708-53379730 CATCCAAAATAGATGGCTCTTGG - Intronic
1159894693 18:73985195-73985217 TTTCCTAGAAAGAGGGCTCATGG + Intergenic
1164513913 19:28918230-28918252 CTTCCCAGACAGATGCCCTATGG - Intergenic
1166271727 19:41718620-41718642 CTTCCACTACATAGGGCTCAGGG - Intronic
1166276512 19:41757711-41757733 CTTCCAAGACAGAGGGCCCTGGG - Intronic
1166445281 19:42853297-42853319 CTCCCAAGGCAGTTGGCTGATGG + Intronic
1166917555 19:46205910-46205932 CTGCCAAGACAGAAAGCACATGG + Intergenic
1166917888 19:46208224-46208246 CTGCCAAGACAGAAAGCACATGG - Intergenic
1167292212 19:48630543-48630565 CTTCCACAACAGCTGGCTCTGGG + Exonic
1168387346 19:55975401-55975423 CTAGCAGGACTGATGGCTCACGG - Intronic
927511791 2:23648584-23648606 CTCCCAAGACAGATAGCTCCCGG - Intronic
927650017 2:24906814-24906836 CTTATAAGACAGATTGCTCAAGG - Intronic
931219853 2:60279179-60279201 TGTCCAGGACAGATGTCTCAAGG - Intergenic
933306714 2:80609525-80609547 ATTGCAAGACAGATTGCTCTTGG - Intronic
933861693 2:86475685-86475707 CTTACAAGACAGATGCCCCATGG - Intronic
934781581 2:96972591-96972613 CTTCCAGGACAGATGTCCCACGG - Exonic
935656294 2:105426540-105426562 CTTCCAGGACTGCTGGCTCAGGG - Intronic
938297240 2:130185857-130185879 CTTCCAGGACAGAGCCCTCAAGG - Intronic
939405369 2:141748755-141748777 CTTCCAAAGCAGAAGGCTCTGGG + Intronic
942025201 2:171903961-171903983 CATCAAAGACAGTAGGCTCAGGG + Intronic
942502195 2:176603421-176603443 GTTCCAAGGCAGATAACTCATGG - Intergenic
1169462826 20:5811234-5811256 GTTCCAAGACAGATGTTTCCAGG + Intronic
1170346887 20:15397077-15397099 TTTCCCAGTCAGATGGCTCAAGG + Intronic
1173029708 20:39343448-39343470 CTCCCACGACAGATGGCTGTGGG - Intergenic
1178595246 21:33947620-33947642 CTTCCAAGATACATAGCCCAGGG + Intergenic
1179349603 21:40595489-40595511 CTTCGAATAGAGATGGCTCTTGG - Intronic
1183667474 22:39253991-39254013 TTTCCAGGGCAGATGGCCCAAGG + Intergenic
1183862614 22:40680730-40680752 CTTCCAAGACAGATGGCTCAGGG + Intronic
949130952 3:499793-499815 CTTTCGATACAGATGACTCAGGG + Intergenic
949844388 3:8354997-8355019 CCTCCAAGACAGAGGGCACAAGG + Intergenic
950681609 3:14588892-14588914 CCTCCAAGACAGGGGCCTCATGG + Intergenic
950824888 3:15808115-15808137 CTTCGGAGACAGATGGGTCTGGG - Intronic
951805519 3:26639920-26639942 CTTCATAGACAGAAGGTTCAGGG + Intronic
953092513 3:39743456-39743478 CATTCATGACAGAGGGCTCATGG - Intergenic
957296126 3:78335190-78335212 CTGCAAAGACAGATGGGTAATGG - Intergenic
958443788 3:94190126-94190148 CTTCCAACACAGATAGCACCTGG - Intergenic
963328792 3:143891672-143891694 AGTTCAAGAGAGATGGCTCATGG + Intergenic
963919792 3:150894346-150894368 CTTCCTAGACATATTCCTCATGG + Intronic
966238635 3:177730218-177730240 CAGCCAACACAGATGGCTGAGGG - Intergenic
966719744 3:183050257-183050279 CTTCCAAAACAGAAAGCACAAGG + Intronic
970420336 4:15899909-15899931 TCTCCAAGACAGATGATTCAGGG + Intergenic
970846350 4:20542987-20543009 CTTACAAGACTAATGGCCCATGG + Intronic
971718464 4:30213073-30213095 GTGCCAAAACATATGGCTCAGGG + Intergenic
972485311 4:39534715-39534737 CTCCCAAGACACATGGGTTATGG - Intergenic
973207108 4:47573038-47573060 CTTCCAAGACTGTTGCATCAGGG + Intronic
976360278 4:84170060-84170082 GTTCCAAGACAGTTGGGTCTAGG + Intergenic
977115119 4:93014660-93014682 TTTCCATGACAAATGGCTTATGG + Intronic
979488925 4:121301802-121301824 CTTCCAGGAAAGATAGCTCAAGG - Intergenic
979798018 4:124871474-124871496 CTTCCAAAACAGATGCATGATGG - Intergenic
979835065 4:125356300-125356322 CTTTCAAGACAAATTACTCAGGG - Intronic
980283406 4:130752290-130752312 CTTCCAAGGCAACTGCCTCAAGG - Intergenic
988612358 5:32738855-32738877 CTTCCATAGGAGATGGCTCATGG + Exonic
991922064 5:71666916-71666938 TGTTCGAGACAGATGGCTCAAGG - Intergenic
993210341 5:84941663-84941685 TTTCCAAGACATATTGTTCAGGG - Intergenic
993282000 5:85937099-85937121 CTTCCAAGACACTTGGCAAATGG - Intergenic
998511091 5:142714532-142714554 CTTCCAAGCCACTTGGCTCTCGG + Intergenic
999609100 5:153350253-153350275 CTGCCAAGCCACAGGGCTCAGGG + Intergenic
1000736082 5:164902308-164902330 CTACCATAACATATGGCTCAAGG - Intergenic
1003519670 6:6847674-6847696 CTTCTAATGCAGAGGGCTCAGGG - Intergenic
1004319709 6:14622731-14622753 CATCCAATACAGAGAGCTCAGGG - Intergenic
1004346410 6:14853335-14853357 CTTCTAAGACAGCTTGCTCTTGG + Intergenic
1007992850 6:46275358-46275380 CTTCAAAGGCAATTGGCTCAGGG - Intronic
1008549796 6:52617302-52617324 GTTCCAAGACAAACGGCACAGGG + Intergenic
1009449928 6:63789057-63789079 CTTCCAAGAGGGCTGGCTGAAGG - Exonic
1010986713 6:82433414-82433436 TTTCCAAGAGAGATGACTAAGGG + Intergenic
1019768186 7:2866608-2866630 CCTCCAACACAGATGTCTCCTGG + Intergenic
1021087161 7:16434525-16434547 CATCCAAGAAAGTTTGCTCAAGG - Intergenic
1021705351 7:23362344-23362366 CTTACAAAACAGATTGCTCAAGG + Intronic
1021802069 7:24316939-24316961 CTTCCAACTCAGATGGTTCAAGG - Intergenic
1023261245 7:38360244-38360266 CTTGCAGGACAGAAGTCTCATGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026681152 7:72467494-72467516 CCTCCAAGACAGCTGGCTGGTGG + Intergenic
1032476059 7:132212148-132212170 ATGCCAAGACAGATGGCTCCTGG + Intronic
1032672559 7:134098775-134098797 CTTCCAAGAGAGATGAGACATGG + Intergenic
1033509815 7:142048670-142048692 CTTCCAAGGCATATGCCTCAAGG - Intronic
1039254045 8:35699368-35699390 GTACCAAAACAGATGGCTCAAGG - Intronic
1041753977 8:61292533-61292555 CTTTGAAGACAGAAGGGTCAAGG + Intronic
1042745354 8:72100764-72100786 CTTCCCAGTCAGAAGGATCATGG + Intronic
1042964893 8:74339765-74339787 CTTTCAGGACAACTGGCTCAGGG + Intronic
1045848666 8:106667017-106667039 CTCACAAGACAGATGGCTAGTGG + Intronic
1057346296 9:94253886-94253908 CTTGCAAGACAACTGCCTCAGGG - Intergenic
1058538987 9:105992504-105992526 CTACCAAGCCAGAGGGGTCATGG + Intergenic
1060168252 9:121438909-121438931 ATTCCAAGTCAGGTGGCACAGGG - Intergenic
1061596849 9:131636118-131636140 CTGCCAAGGAAGATGGCACAGGG - Intronic
1190113559 X:47610790-47610812 CTTCCATGGCAGATTGCACAGGG + Intronic
1190423416 X:50309150-50309172 CTTGCAATACAGATAGCTCTTGG - Exonic
1192222544 X:69207273-69207295 TTTCCAACACAGATTGCTCATGG + Intergenic
1192397487 X:70796529-70796551 TTTCCAAGACTGATGCCACAAGG - Intronic
1192792805 X:74399658-74399680 CTTCCCAAACAGATGGCACTAGG + Intergenic
1197701584 X:129604157-129604179 CTTTCAAGAAATGTGGCTCACGG + Intergenic
1201788238 Y:17808628-17808650 CTTGGAAGCAAGATGGCTCAGGG - Intergenic
1201813315 Y:18097360-18097382 CTTGGAAGCAAGATGGCTCAGGG + Intergenic