ID: 1183862617

View in Genome Browser
Species Human (GRCh38)
Location 22:40680742-40680764
Sequence ATGGCTCAGGGCACTCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183862612_1183862617 -10 Left 1183862612 22:40680729-40680751 CCTTCCAAGACAGATGGCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1183862617 22:40680742-40680764 ATGGCTCAGGGCACTCTGGTAGG 0: 1
1: 0
2: 1
3: 8
4: 185
1183862608_1183862617 24 Left 1183862608 22:40680695-40680717 CCTCTGGTGCCTGCAGGAGGCAG 0: 1
1: 1
2: 3
3: 54
4: 493
Right 1183862617 22:40680742-40680764 ATGGCTCAGGGCACTCTGGTAGG 0: 1
1: 0
2: 1
3: 8
4: 185
1183862610_1183862617 15 Left 1183862610 22:40680704-40680726 CCTGCAGGAGGCAGGCATGTTGT 0: 1
1: 0
2: 0
3: 15
4: 198
Right 1183862617 22:40680742-40680764 ATGGCTCAGGGCACTCTGGTAGG 0: 1
1: 0
2: 1
3: 8
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183862617 Original CRISPR ATGGCTCAGGGCACTCTGGT AGG Intronic
900627494 1:3615670-3615692 GTGGCTCAGGGCCCTCTTGCAGG - Intergenic
902691738 1:18114118-18114140 ATGGTTCATGGCCCTCTGGCTGG + Intronic
904914424 1:33959760-33959782 ATGGGACAGGGCAGTCTGGGAGG - Intronic
905254591 1:36672018-36672040 ATGATTTAGGGCACTCTGGAGGG - Intergenic
906112000 1:43330352-43330374 ATGACTCAGGGCCAACTGGTGGG - Intergenic
908491641 1:64650326-64650348 AAAGCTCAGGGGACTGTGGTGGG + Intronic
910079980 1:83330063-83330085 ATTGCTCATGGCTCTCTGCTTGG + Intergenic
910454819 1:87386222-87386244 ATTGCTCAGGGTACTCGAGTGGG + Intergenic
915008641 1:152664201-152664223 ATGGAGCTGGGCACTGTGGTGGG - Exonic
915009927 1:152676111-152676133 ATGGAGCTGGGCACTGTGGTGGG - Exonic
916117651 1:161501096-161501118 ATGACTCATGGTACTCTGCTAGG + Intergenic
916718917 1:167468446-167468468 ATAGCTCAGGCCTCTCTGATGGG + Intronic
918499757 1:185180880-185180902 ATCAGTCAGGGGACTCTGGTTGG - Intronic
920230588 1:204467197-204467219 CTGAGTCAGGGCACCCTGGTAGG - Intronic
920304888 1:205012316-205012338 TCTGCTCAGGGCACTCTGCTAGG + Intronic
922607120 1:226896484-226896506 TTGGCCCTGGGCACTGTGGTGGG + Intergenic
1062822910 10:548240-548262 AGGGCTCAGGGCCCCCAGGTGGG + Intronic
1063969869 10:11374055-11374077 ATGCCTCAGGGCTCCCTGCTGGG - Intergenic
1064004894 10:11691687-11691709 AGGGCTCAGGGCTCTCAGGGAGG + Intergenic
1064244165 10:13656384-13656406 CTGGCCCAGTGCACTCTGGAGGG + Intronic
1067470479 10:46534156-46534178 AGGGTTCAGTGCACTCTGTTCGG + Intergenic
1069634187 10:69915382-69915404 ATGGTTCAGGGGTCACTGGTGGG + Intronic
1069799639 10:71074148-71074170 GTCGCCCAGGGCACACTGGTGGG - Intergenic
1070751924 10:78968988-78969010 ATAGCTTAGGGCACTTTGGAGGG - Intergenic
1070778611 10:79124789-79124811 ATGGGTCAGGGCAGTCCGGCTGG + Intronic
1071028722 10:81146225-81146247 ATGGCTCAAGCCACTCAGGAGGG - Intergenic
1071263078 10:83938711-83938733 ATGGCTCTGAGCACTCGGCTTGG + Intergenic
1071277390 10:84068145-84068167 GTGGCTCACAGCACTCTGGGAGG + Intergenic
1074833230 10:117264247-117264269 ATGGCCCAGGGCACTGTTGCAGG + Intronic
1083376038 11:62222178-62222200 ATGGCTGAGGGCAGACTGATGGG - Intergenic
1083771445 11:64869912-64869934 AGGGCTCAGGACACACAGGTGGG + Intronic
1087102712 11:94380727-94380749 CTGGCTCAGGGAAGTCTGGCAGG + Exonic
1090037293 11:123260090-123260112 AGGGCTCAGTGCACTGTGGTAGG - Intergenic
1090668318 11:128929792-128929814 CTGGCTCAGGGGCTTCTGGTAGG + Intergenic
1091464531 12:672227-672249 ATTGCACAGGGGACTCCGGTCGG + Intergenic
1092586218 12:9904057-9904079 ATGGATCAGGGCAGACTGATTGG + Intronic
1092953967 12:13532381-13532403 ATGGCTCAGGGCCCACTGCAGGG + Intergenic
1097732264 12:63141749-63141771 ATGCATCTGGGCACTTTGGTAGG - Intergenic
1099207006 12:79740075-79740097 GTGGCTCAGGCCACTTTGGGAGG - Intergenic
1099434144 12:82623514-82623536 ATGTCCCAGGGCTCTCTGCTGGG + Intergenic
1101724429 12:107377271-107377293 AGGCCTCAGGCCATTCTGGTGGG - Intronic
1101949962 12:109167000-109167022 ATGGGTCTCGGCACTCTGGGTGG + Intronic
1102024343 12:109705087-109705109 ATGCCTCAGGGACCTCTAGTTGG - Intergenic
1113882911 13:113637820-113637842 ATGGCTCAGGGAACTGTTGGAGG + Exonic
1117700711 14:58410495-58410517 ATGGCCCTGGGAATTCTGGTTGG - Intronic
1119683884 14:76614694-76614716 ATGGAGCAAGGAACTCTGGTGGG - Intergenic
1119782535 14:77286675-77286697 TTGGCTCAGGGCTGTGTGGTGGG - Intronic
1120969482 14:90195442-90195464 ATGGCTCACAGCACTTTGGGAGG + Intergenic
1121778505 14:96606741-96606763 ATGGGAGAGGGCACTGTGGTGGG + Intergenic
1122389899 14:101373140-101373162 CTGGCTCACAGCACTCAGGTAGG - Intergenic
1122402717 14:101476730-101476752 AGGGCTCTGGGCACTCGGCTGGG - Intergenic
1122953401 14:105058747-105058769 ATGGCTCAGGGCATGCAGGGGGG + Intronic
1125932178 15:43608183-43608205 AGGGCTCTGGGCACCCTGGCAGG - Exonic
1125945276 15:43707657-43707679 AGGGCTCTGGGCACCCTGGCAGG - Intergenic
1127615491 15:60681403-60681425 ATGGCTGAGGGCACTCCCATAGG - Intronic
1127630075 15:60819968-60819990 ATGCCCCAGGGCAGTCTGGAAGG + Intronic
1128529498 15:68434034-68434056 AAGGATCAGGGCATGCTGGTGGG + Intergenic
1129323999 15:74790023-74790045 ATGGCTCTGGGCACACAGGAAGG + Intronic
1129948060 15:79559457-79559479 ATGGCTCAGGGAACTGTGGGAGG - Intergenic
1130899736 15:88198342-88198364 ATGGCTCAGAGGACACTGGAGGG - Intronic
1135484459 16:22851919-22851941 ATGGCTCAGGGTATTCTCATAGG - Intronic
1136619388 16:31418082-31418104 CAGGCGCAGGGCACTCTGATGGG - Exonic
1137013443 16:35347195-35347217 ATGTGTCAGGGCATCCTGGTGGG + Intergenic
1140539988 16:75748073-75748095 ATTTCTCAGGGAATTCTGGTAGG - Intronic
1141068808 16:80934843-80934865 ATGGCTAAGTACATTCTGGTTGG + Intergenic
1141823409 16:86463147-86463169 ATGGCTCAGTACATGCTGGTGGG + Intergenic
1145737706 17:27244663-27244685 CTGGCACAGGCCCCTCTGGTTGG + Intergenic
1147343053 17:39766641-39766663 CTGTCTCAGGGGACACTGGTCGG + Intronic
1148131989 17:45267559-45267581 TTGGCTCTGGGGGCTCTGGTGGG + Exonic
1153005004 18:490229-490251 ATGGCTGAGGGCTCCCTGGCTGG - Intronic
1153489581 18:5633007-5633029 ATGGCTCACAGCACTTTGGGAGG + Intergenic
1154287087 18:13069271-13069293 GAGGTTCAGGGCACTCTGTTGGG - Intronic
1155630255 18:27884893-27884915 GTGGCTCATGGCATTCTGGGAGG + Intergenic
1156458750 18:37309381-37309403 AAGGCTCAAGGCACTCTTATTGG + Intronic
1157350059 18:46876068-46876090 ATGGATCAGGGCAGACTGATAGG - Intronic
1157575938 18:48743126-48743148 ATGCCTCAGGGTGCTCTGGCCGG + Intronic
1160387134 18:78503532-78503554 CTGGCTCAGGGCACTGTGCAGGG + Intergenic
1168507842 19:56951352-56951374 AGGGTTTGGGGCACTCTGGTTGG - Intergenic
1168693922 19:58394596-58394618 GTGGGTGAGGGCACTCCGGTTGG + Intronic
925145265 2:1578475-1578497 ATGGCTCTGGCCACTCTGCGGGG + Intergenic
925197006 2:1933774-1933796 GTGGCTCATGGCACTGTGCTAGG - Intronic
925593462 2:5532698-5532720 GTGGCTCACAGCACTCTGGGAGG - Intergenic
925768152 2:7257795-7257817 CTTGCTCAGGACACTCTGCTGGG - Intergenic
926009376 2:9396177-9396199 AAGGCTCAGGACCCTCTGGAAGG - Intronic
928111943 2:28517500-28517522 CAGGCTCAGGACACTCTGGTAGG + Intronic
929598631 2:43191435-43191457 ATGTCCCAGGGCTCTCTGATGGG + Intergenic
930348902 2:50223873-50223895 ATTGCTCTGGAAACTCTGGTTGG - Intronic
931721853 2:65072463-65072485 AGGGCGCCGGGCACTCTGGCTGG - Exonic
933909860 2:86930186-86930208 ATGAGGGAGGGCACTCTGGTGGG + Intronic
934022866 2:87973202-87973224 ATGAGGGAGGGCACTCTGGTGGG - Intergenic
934985595 2:98882550-98882572 ATGCCTCTGGGGACTCTGTTGGG + Intronic
939572319 2:143855089-143855111 TTGCCTCAGCGCACTCTGTTAGG + Intergenic
940116178 2:150210861-150210883 ATGCTTCAGGGAAATCTGGTGGG - Intergenic
941606667 2:167605732-167605754 ATTGTTCCAGGCACTCTGGTAGG + Intergenic
942449917 2:176102301-176102323 AAGGCTCAGGGCTCTCTGTGAGG - Intergenic
942961405 2:181833728-181833750 CTGCCTGTGGGCACTCTGGTTGG - Intergenic
946032399 2:216715651-216715673 AGGACTCAGGGAACTCTGGCAGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947428868 2:230008074-230008096 ATGTCTCAGGGGACTCTAGAAGG + Intronic
1169205604 20:3738727-3738749 ATGGGTCAGGGCAGAATGGTGGG - Intronic
1170928512 20:20747279-20747301 GTGACACAGAGCACTCTGGTAGG - Intergenic
1174369707 20:50078245-50078267 GTGGCTCACGGCACTTTGGGAGG + Intergenic
1175431653 20:58909233-58909255 AGGGCTCAGAGTCCTCTGGTGGG - Intronic
1180303455 22:11055075-11055097 ATGCCCCAGGGCCCTCTGCTGGG - Intergenic
1181412508 22:22734230-22734252 ATGGCACAGTGCCCTCTGCTTGG - Intergenic
1181591691 22:23889395-23889417 TTGGCTCTGGCCACTCTGGGAGG + Intronic
1182065017 22:27424764-27424786 AGAGCTCAGGGCCATCTGGTGGG + Intergenic
1182916485 22:34037494-34037516 GTGGCTGATGGCACACTGGTTGG + Intergenic
1183862617 22:40680742-40680764 ATGGCTCAGGGCACTCTGGTAGG + Intronic
1185279836 22:49965345-49965367 TGGACTCAGGGCACGCTGGTTGG - Intergenic
953406159 3:42660824-42660846 ATTGGTCAGGGTACTCAGGTTGG - Intronic
953907187 3:46874309-46874331 ATGCCTCAGGGGACACTGGCTGG - Intronic
954586560 3:51741734-51741756 ATGGGTCAGGGCAGACTGATTGG - Intergenic
955240501 3:57173888-57173910 CTGGCTCAGGGCACTCAGTGGGG + Intergenic
956274472 3:67483269-67483291 ATTGCTCAGAACACTTTGGTAGG + Intronic
960659725 3:120044335-120044357 ATGGCTAAGGGCAGACTGATGGG - Intronic
963442250 3:145355343-145355365 ATGGCTAAGGGCAGACTGATGGG + Intergenic
968394118 4:217468-217490 ATGTCACAGAGCACTCTGCTGGG - Intergenic
969070625 4:4535509-4535531 GTGTCTCTGGGCCCTCTGGTTGG + Intronic
969313312 4:6366838-6366860 AAGGCACAGGGCACTGTGGAGGG + Intronic
969457066 4:7306249-7306271 CTGGCTCAGGGCACTGTGCTGGG + Intronic
969478268 4:7433422-7433444 TGGGCCCAGGGCACACTGGTCGG + Exonic
971166548 4:24189828-24189850 GGAGCTCAGGGCAGTCTGGTGGG - Intergenic
975915541 4:79321158-79321180 ATGGCCCAGGGAACTCTGTTAGG - Intronic
976271140 4:83231420-83231442 TTGGTTCAGGGCACTTTGGGAGG + Intergenic
978311277 4:107387140-107387162 ATGGCTAAGGGCAGACTGATGGG - Intergenic
978542995 4:109838744-109838766 AAGGCTGATGGCATTCTGGTGGG + Intronic
980040190 4:127930168-127930190 ATGGCTCAGTGCAGCCTGATGGG - Intronic
984145000 4:176049546-176049568 AGAGGTCAGGACACTCTGGTAGG + Intergenic
985281099 4:188286028-188286050 ATGGCTCAAGCCACTTTGGGAGG + Intergenic
985720876 5:1488056-1488078 ATGGCTCAGGGTACCCTTCTTGG - Intronic
985868678 5:2536781-2536803 ATGCCTCTGGGGACTCTGCTGGG - Intergenic
992803817 5:80317246-80317268 GTGGCTCATGCCACTCTGGGAGG - Intergenic
993760910 5:91796028-91796050 CTGGCTCTGGGCACTCTGCATGG - Intergenic
995742745 5:115371956-115371978 ATGGATGAGGGCCCTATGGTTGG + Intergenic
1002495073 5:179606292-179606314 ATGGCACAGGGCACTGCAGTGGG - Intronic
1002969074 6:1995744-1995766 ATGGCTCAGGGCACGTGGCTTGG + Intronic
1003623634 6:7724375-7724397 ATGGATGAGGGCACCTTGGTGGG - Intergenic
1003887092 6:10531666-10531688 AGGGCTCAGGAAAGTCTGGTGGG + Intronic
1005380076 6:25224776-25224798 ATGGCAGAGGGCAGTGTGGTTGG + Intergenic
1006076527 6:31536357-31536379 ATGGCTCTGGGTTCCCTGGTTGG - Intronic
1006845073 6:37056218-37056240 TGGGCTCAGGGCACTCTAGTGGG + Intergenic
1006874235 6:37281552-37281574 ATTGTGCAGGGCACACTGGTGGG + Intronic
1009804226 6:68581434-68581456 AATGCTCAGGCCCCTCTGGTGGG - Intergenic
1011127584 6:84023426-84023448 ATGGCTCCCAGCACTTTGGTAGG - Intergenic
1014307983 6:119766187-119766209 ATGGCTAAGGGCAGACTGATGGG + Intergenic
1016877832 6:148881367-148881389 ATGGCTCAAGTCCCTCTGATGGG - Intronic
1018105667 6:160483908-160483930 AATCCTCAGGGCACTCTGGGGGG - Intergenic
1018416615 6:163607200-163607222 ATGGCCCAGCCCACTCTTGTTGG + Intergenic
1020002803 7:4765322-4765344 CTGGCTCAGGGCACACAGGGAGG - Exonic
1020812673 7:12864946-12864968 ATGGCAGCGGGCACTCTGGATGG + Intergenic
1022197436 7:28082663-28082685 ATGGCTCATGGGTGTCTGGTGGG - Intronic
1023621936 7:42082300-42082322 AGGGCTCAGTGCACTGTGGGAGG + Intronic
1024590933 7:50882360-50882382 ATGTCCCAGGCCACTCTGGCGGG - Intergenic
1024943551 7:54786080-54786102 ATGGCTAAGGGCAGTTTGGTTGG - Intergenic
1026489275 7:70848749-70848771 ATGGCTAAGGGCAAACTGATGGG - Intergenic
1027469213 7:78552745-78552767 TTGGCTCAGGGCACCCTAGCTGG - Intronic
1034240624 7:149608199-149608221 CTGGCTAAGGTCACCCTGGTGGG - Intergenic
1035735538 8:1884431-1884453 ATGGCTTAGGAAACTCGGGTTGG - Intronic
1036167182 8:6446942-6446964 TTGACTCAAGGCACCCTGGTGGG + Intronic
1036659853 8:10700917-10700939 ATGGCTCTGGGTCCTCTTGTGGG - Intronic
1041680287 8:60582203-60582225 ATGGCTCATGCCACTTTGGGAGG - Intronic
1041954665 8:63544152-63544174 ATTGCTCAGTGCTCTCAGGTGGG + Intergenic
1048179896 8:132185060-132185082 ATGCCTCAGGGCACCCAGGGAGG - Intronic
1048256608 8:132909669-132909691 AAGGCCCAGGTCACACTGGTAGG - Intronic
1050480968 9:6086432-6086454 ATGGCTAAGGGCAGACTGATGGG - Intergenic
1050491863 9:6196864-6196886 ATGGCTCATGCCACTTTGGAAGG + Intergenic
1053085237 9:35213989-35214011 ATGTATCATGACACTCTGGTTGG - Intronic
1053579724 9:39392000-39392022 ATGACTCAGGGCACACAGGGTGG - Intergenic
1053844240 9:42220077-42220099 ATGACTCAGGGCACACAGGATGG - Intergenic
1054101311 9:60950809-60950831 ATGACTCAGGGCACACAGGGTGG - Intergenic
1054122684 9:61226172-61226194 ATGACTCAGGGCACACAGGGTGG - Intergenic
1054585040 9:66956072-66956094 ATGACTCAGGGCACACAGGGTGG + Intergenic
1054858542 9:69926701-69926723 ATGGCTAAGGGCAGACTGATGGG + Intergenic
1055078222 9:72239026-72239048 ATGGCTAGAGGCACTGTGGTAGG - Intronic
1055762389 9:79622702-79622724 ATGGCACCAGGCACTGTGGTAGG - Intronic
1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG + Exonic
1061098047 9:128471509-128471531 AGGGCTCAAGGCAGCCTGGTAGG - Intronic
1061589843 9:131591270-131591292 AAGGCTCAGGGCACACAGGAAGG + Intronic
1061884143 9:133583196-133583218 ATGGCTGAGGGCCCACTGCTAGG + Intronic
1187529433 X:20082985-20083007 ATTGTTCAGGGCAGTCTGGTTGG + Intronic
1188009209 X:25039666-25039688 ATGACCCAGGGAACTCTAGTGGG + Intergenic
1189002566 X:36962398-36962420 ATGGCTCAGGGAACTGTTGGAGG - Intergenic
1190627145 X:52346821-52346843 AGTGCTCAGGGCAGTCAGGTGGG + Intergenic
1191215975 X:57932691-57932713 ATGACTCATGGCAGGCTGGTAGG + Intergenic
1191800795 X:65077206-65077228 ATGGCACAAAGCACTCTGCTGGG + Intergenic
1192681512 X:73258359-73258381 ATGGCTAAGGGCAGACTGATGGG + Intergenic
1194807299 X:98345027-98345049 ATGGCTGAATGCAGTCTGGTTGG + Intergenic
1196862765 X:120043172-120043194 AGGGGTCAGGGCACTGGGGTGGG - Intergenic
1196880337 X:120193172-120193194 AGGGGTCAGGGCACTGGGGTGGG + Intergenic
1198078553 X:133217244-133217266 ATGGCTCAGGGAACTTTTGGAGG - Exonic
1198105282 X:133455786-133455808 ATGGATTAAGGCATTCTGGTTGG + Intergenic
1199229927 X:145424866-145424888 ATTACTCAGGGCTCTCTGGAAGG + Intergenic
1200858119 Y:7960942-7960964 TTGGCTCAGTGCACTCTGAGTGG - Intergenic
1201289148 Y:12405884-12405906 ATGTCTGAGGACACACTGGTTGG + Intergenic