ID: 1183866165

View in Genome Browser
Species Human (GRCh38)
Location 22:40705929-40705951
Sequence CACAAGAGCTTCCATCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183866160_1183866165 6 Left 1183866160 22:40705900-40705922 CCCGGGATGAGGTCCAGAAGGGT No data
Right 1183866165 22:40705929-40705951 CACAAGAGCTTCCATCCCCTTGG No data
1183866161_1183866165 5 Left 1183866161 22:40705901-40705923 CCGGGATGAGGTCCAGAAGGGTC No data
Right 1183866165 22:40705929-40705951 CACAAGAGCTTCCATCCCCTTGG No data
1183866162_1183866165 -7 Left 1183866162 22:40705913-40705935 CCAGAAGGGTCCCAAGCACAAGA No data
Right 1183866165 22:40705929-40705951 CACAAGAGCTTCCATCCCCTTGG No data
1183866156_1183866165 21 Left 1183866156 22:40705885-40705907 CCAGGGGAAGAGATACCCGGGAT No data
Right 1183866165 22:40705929-40705951 CACAAGAGCTTCCATCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183866165 Original CRISPR CACAAGAGCTTCCATCCCCT TGG Intergenic
No off target data available for this crispr