ID: 1183868179

View in Genome Browser
Species Human (GRCh38)
Location 22:40720739-40720761
Sequence CCTTATAAGAAGTGGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183868179_1183868184 1 Left 1183868179 22:40720739-40720761 CCGGCCTCCCACTTCTTATAAGG No data
Right 1183868184 22:40720763-40720785 CATAAATCATCTTTGATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183868179 Original CRISPR CCTTATAAGAAGTGGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr