ID: 1183868831

View in Genome Browser
Species Human (GRCh38)
Location 22:40725226-40725248
Sequence AAGGAGAAGGAAGATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183868831_1183868844 30 Left 1183868831 22:40725226-40725248 CCACCCTCATCTTCCTTCTCCTT No data
Right 1183868844 22:40725279-40725301 TTAACTTGCCATCTGCGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183868831 Original CRISPR AAGGAGAAGGAAGATGAGGG TGG (reversed) Intergenic
No off target data available for this crispr