ID: 1183878445

View in Genome Browser
Species Human (GRCh38)
Location 22:40804770-40804792
Sequence CACAATCGACACAGACCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183878445_1183878449 19 Left 1183878445 22:40804770-40804792 CCTCCGGGTCTGTGTCGATTGTG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1183878449 22:40804812-40804834 TGAGAAAATGGCCCAAGGCCAGG 0: 1
1: 0
2: 1
3: 43
4: 440
1183878445_1183878450 24 Left 1183878445 22:40804770-40804792 CCTCCGGGTCTGTGTCGATTGTG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1183878450 22:40804817-40804839 AAATGGCCCAAGGCCAGGTGTGG 0: 1
1: 1
2: 10
3: 109
4: 702
1183878445_1183878448 14 Left 1183878445 22:40804770-40804792 CCTCCGGGTCTGTGTCGATTGTG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1183878448 22:40804807-40804829 TCTTGTGAGAAAATGGCCCAAGG 0: 1
1: 0
2: 2
3: 20
4: 200
1183878445_1183878447 7 Left 1183878445 22:40804770-40804792 CCTCCGGGTCTGTGTCGATTGTG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1183878447 22:40804800-40804822 TCTGTTGTCTTGTGAGAAAATGG 0: 1
1: 1
2: 1
3: 24
4: 309
1183878445_1183878451 27 Left 1183878445 22:40804770-40804792 CCTCCGGGTCTGTGTCGATTGTG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1183878451 22:40804820-40804842 TGGCCCAAGGCCAGGTGTGGTGG 0: 1
1: 5
2: 38
3: 311
4: 1729

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183878445 Original CRISPR CACAATCGACACAGACCCGG AGG (reversed) Intronic
902277858 1:15352333-15352355 CACAAACGCCATAGACCTGGAGG - Intronic
917731592 1:177880412-177880434 GACCATCCACACAGACTCGGAGG + Intergenic
922731057 1:227948896-227948918 CACATTCCAGACAGACCTGGGGG + Intergenic
1067087966 10:43252856-43252878 CACCCTCGACACAGACCCACTGG + Intronic
1087735493 11:101827915-101827937 CACCATCAACACAGGCCCAGAGG - Intronic
1090627443 11:128619064-128619086 CACCATGGAAACAGAGCCGGAGG + Intergenic
1091049235 11:132352614-132352636 CACACTGGACACAGGCCTGGGGG - Intergenic
1103724673 12:122991752-122991774 CACACTCGGCACAGCCCGGGCGG + Intronic
1110574422 13:77039593-77039615 ACAAATCGCCACAGACCCGGTGG + Intergenic
1112805753 13:103162420-103162442 CATAATCTCCACATACCCGGTGG - Intergenic
1113868448 13:113543716-113543738 CACACTCAACAAAGCCCCGGCGG - Intronic
1113964930 13:114147569-114147591 CACAACCGACCCAGCCCCCGAGG + Intergenic
1113964982 13:114147714-114147736 CACAACCGACCCAGCCCCCGAGG + Intergenic
1113965013 13:114147801-114147823 CACAACCGACCCAGCCCCCGAGG + Intergenic
1113965023 13:114147830-114147852 CACAACCGACCCAGCCCCCGAGG + Intergenic
1113965044 13:114147888-114147910 CACAACCGACCCAGCCCCCGAGG + Intergenic
1113965241 13:114149175-114149197 CACAACCGACCCAGCCCCCGTGG - Intergenic
1122305631 14:100764594-100764616 CAGAATTGACACATACCCAGGGG - Intergenic
1148850128 17:50550604-50550626 CACCATGGACACACACCCGGTGG - Exonic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
927253918 2:21022995-21023017 CACAAACTCCACAGACACGGAGG + Exonic
930712898 2:54566031-54566053 CATAATCAAAACAGACCAGGTGG + Intronic
932490931 2:72119844-72119866 CACAATCCACACCCACCCGTTGG + Intergenic
937912787 2:127083939-127083961 CAAACACGACTCAGACCCGGCGG - Intronic
937993910 2:127679225-127679247 CACCATCTACACAGACCCCAGGG - Intronic
941103193 2:161321496-161321518 CCCAATTGACACAAACCTGGCGG + Intronic
1174069268 20:47888477-47888499 CTCAAGGGAAACAGACCCGGGGG - Intergenic
1175167375 20:57054376-57054398 CACAACCCACACAGAATCGGAGG + Intergenic
1176073804 20:63239512-63239534 CACACTCAGCACAGACCAGGTGG - Exonic
1179518931 21:41929462-41929484 CACAACAGACACAGACCCTGTGG + Intronic
1183878445 22:40804770-40804792 CACAATCGACACAGACCCGGAGG - Intronic
950660964 3:14466799-14466821 CACACCCGCCACAGGCCCGGTGG - Intronic
954331938 3:49895865-49895887 CACCATCTACGCAGACCTGGGGG + Exonic
956601973 3:71032253-71032275 CACAATTGCCACAGCCCAGGTGG - Intronic
975625996 4:76347846-76347868 AAAAATCGACACAGGCTCGGAGG + Intronic
985425917 4:189829775-189829797 CACAAACCACGCAGACCCGTCGG + Intergenic
985425928 4:189829859-189829881 CACAAACCACGCAGACCCGTCGG + Intergenic
990963319 5:61417534-61417556 CACAATCCACACAGCCCCTTAGG - Intronic
1002810288 6:621646-621668 CACGATCGACTCAGTCTCGGTGG - Intronic
1008494883 6:52122990-52123012 GACAAGAGACACAGACCTGGGGG + Intergenic
1024572030 7:50731138-50731160 CACAAACTACACAGACTCAGGGG + Intronic
1040599914 8:48872686-48872708 CACAGTCTACACACACCAGGTGG + Intergenic
1062095834 9:134702762-134702784 AACAATCGACAGAGCCCAGGTGG - Intronic