ID: 1183879900

View in Genome Browser
Species Human (GRCh38)
Location 22:40818781-40818803
Sequence TCACGCTTGCCGCGGGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183879900_1183879905 -8 Left 1183879900 22:40818781-40818803 CCACTTGCCCGCGGCAAGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1183879905 22:40818796-40818818 AAGCGTGAAGACAGGCTGTAGGG No data
1183879900_1183879906 15 Left 1183879900 22:40818781-40818803 CCACTTGCCCGCGGCAAGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1183879906 22:40818819-40818841 AAGCATGTGACTAAGCAACACGG 0: 1
1: 0
2: 0
3: 10
4: 143
1183879900_1183879904 -9 Left 1183879900 22:40818781-40818803 CCACTTGCCCGCGGCAAGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1183879904 22:40818795-40818817 CAAGCGTGAAGACAGGCTGTAGG 0: 1
1: 0
2: 0
3: 19
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183879900 Original CRISPR TCACGCTTGCCGCGGGCAAG TGG (reversed) Intronic
900525843 1:3128237-3128259 TCACGTTTGACGGGGCCAAGAGG + Intronic
1072564550 10:96606628-96606650 TCACACTTGCCAGGGGGAAGGGG + Intronic
1104935911 12:132364320-132364342 TCATCCTTGCCTCGGGCAATGGG + Intergenic
1124983235 15:34583195-34583217 CCACTCTCGGCGCGGGCAAGTGG - Intronic
1127735357 15:61834301-61834323 GCACGCTTCCCGCGGGACAGAGG + Intergenic
1132981540 16:2740719-2740741 CCACGCTTGCCCTGGGCAGGAGG + Intergenic
1135271505 16:21073690-21073712 TTATGCTTGCTTCGGGCAAGAGG - Intronic
1139559700 16:67734275-67734297 TCAGGCTTGCAGATGGCAAGTGG + Intronic
1151345614 17:73499521-73499543 TCACGCTTGCCTCTCGGAAGGGG + Intronic
1154441462 18:14393247-14393269 TCACGCTGGCCGGGAGCAACGGG + Intergenic
1161531476 19:4792505-4792527 TCACGCTGGCCGCGAGCAGCGGG - Exonic
1161641906 19:5429228-5429250 TCAAGGTTGCCGAGGGCAATGGG + Intergenic
1162727041 19:12696100-12696122 TCAGGCTTGGGGCGGGGAAGAGG - Intronic
1163459071 19:17425369-17425391 GCACTCTTGCACCGGGCAAGTGG + Intronic
932410828 2:71546783-71546805 TCTCGCTTGCGCCAGGCAAGAGG - Intronic
1176454598 21:6897928-6897950 TCACGCTGGCCGGGAGCAACGGG - Intergenic
1176832771 21:13762976-13762998 TCACGCTGGCCGGGAGCAACGGG - Intergenic
1183358903 22:37373316-37373338 TCACGCTTGGAGCGGGTCAGCGG + Exonic
1183879900 22:40818781-40818803 TCACGCTTGCCGCGGGCAAGTGG - Intronic
949413960 3:3797332-3797354 TCACTCTTGCCTTGGGGAAGAGG + Intronic
954076880 3:48188087-48188109 ACGCGGCTGCCGCGGGCAAGCGG + Exonic
963249577 3:143090644-143090666 TGAGGCTTGCTGCTGGCAAGCGG - Intergenic
1018025216 6:159800421-159800443 TCAAGCTCGCCCGGGGCAAGGGG - Intronic
1041244781 8:55879912-55879934 CCCCGCTTGCCGCGGGCTGGAGG - Exonic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1060538785 9:124415231-124415253 TCACACTAGCCGCGGGCCACAGG + Intronic