ID: 1183884053

View in Genome Browser
Species Human (GRCh38)
Location 22:40862240-40862262
Sequence GACTCTGGACTAGCTCTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183884053_1183884056 3 Left 1183884053 22:40862240-40862262 CCAAATAGAGCTAGTCCAGAGTC 0: 1
1: 0
2: 1
3: 4
4: 56
Right 1183884056 22:40862266-40862288 CCAGACCATCCTGAATCCTCTGG 0: 1
1: 0
2: 1
3: 30
4: 204
1183884053_1183884060 29 Left 1183884053 22:40862240-40862262 CCAAATAGAGCTAGTCCAGAGTC 0: 1
1: 0
2: 1
3: 4
4: 56
Right 1183884060 22:40862292-40862314 GTTTCCCCTGTATGTTTCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183884053 Original CRISPR GACTCTGGACTAGCTCTATT TGG (reversed) Intronic
901124586 1:6920072-6920094 GACTCTGGACTTGGACTTTTGGG - Intronic
906205432 1:43984061-43984083 GACTCTGGACTAGGACTAGCAGG - Intronic
910862167 1:91752583-91752605 GCCTCTGGACTAGGTATTTTAGG + Intronic
914712769 1:150230531-150230553 GTCTCTGGACTTGCTTTTTTTGG - Intronic
916975349 1:170071642-170071664 GAGACTGGATTAGCTCTCTTGGG - Intronic
1067429648 10:46234585-46234607 GACTCTGGACTCCCTCACTTGGG + Intergenic
1068378927 10:56222425-56222447 CACGCAGGACTAGCTTTATTTGG + Intergenic
1077876775 11:6315850-6315872 GGCTCTGCAGTAGCTCCATTTGG - Intergenic
1088925796 11:114301059-114301081 GATTCTGGCCTAGATCTAATAGG - Intronic
1094604459 12:31938600-31938622 TCCTCTGGACTAGTTCTATTAGG + Intergenic
1098371321 12:69763285-69763307 GACTCTGGTGAAGCTCTCTTGGG + Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1111392516 13:87615575-87615597 GATTCTGCACTAACTCTATGGGG - Intergenic
1128341443 15:66825255-66825277 GACTCTGGGCTCGCACTACTGGG + Intergenic
1130882144 15:88064592-88064614 GACTCTGGTCTAGGTCTGTCTGG + Intronic
1131925988 15:97384410-97384432 GACTCTGGACAAGCACAATCAGG - Intergenic
1132811313 16:1799276-1799298 GACTCTGGACTTGGACTTTTGGG + Intronic
1135831815 16:25781043-25781065 GACTTTGGACTTGGTTTATTGGG + Intronic
1141715455 16:85724389-85724411 GACTCTGGACTTGCTGGGTTGGG + Intronic
1144155488 17:12496442-12496464 GACTAGTGACAAGCTCTATTTGG + Intergenic
1147787931 17:42993237-42993259 GACTCTAGAGTGGTTCTATTTGG + Exonic
1150101485 17:62427678-62427700 GAATCTGGCCTAACTGTATTAGG - Intronic
1156747244 18:40407156-40407178 GACTCTGGAGTGTCTCTTTTTGG - Intergenic
1159070065 18:63613272-63613294 GACTTTGGACTTGGACTATTGGG - Intergenic
1162853626 19:13451135-13451157 GACTCTGGGCTAGCTCTCATGGG - Intronic
927028718 2:19098087-19098109 GCCTCTGCACTGACTCTATTAGG + Intergenic
927389908 2:22583100-22583122 GACTCTGGATTAGGACTTTTGGG + Intergenic
928251115 2:29681614-29681636 GACTCTGTCCTATCTCCATTGGG + Intronic
931563289 2:63587974-63587996 AACTCTGGAAGAGCTCCATTTGG + Intronic
933724552 2:85419070-85419092 GAGACTGGACTAGGTCTGTTAGG + Intronic
938206086 2:129425037-129425059 GACTCTGGAGTTCCTATATTAGG - Intergenic
938234701 2:129696284-129696306 GACTCTGGACTTGGACTTTTGGG + Intergenic
941152420 2:161931279-161931301 GACTCTGGCCTAGCTTCTTTTGG + Intronic
944138831 2:196432624-196432646 GACTCTGTTCTAGATCAATTAGG - Intronic
1176458117 21:6930326-6930348 GACACTTGATTAGCTCTATGTGG + Intergenic
1176836291 21:13795421-13795443 GACACTTGATTAGCTCTATGTGG + Intergenic
1179271869 21:39857812-39857834 GACTTTGGACTTGGTCTTTTGGG - Intergenic
1182446425 22:30392457-30392479 GACTCTATTTTAGCTCTATTTGG + Intronic
1182828736 22:33287445-33287467 GACTCTGAAATAGATCTATCTGG - Intronic
1183884053 22:40862240-40862262 GACTCTGGACTAGCTCTATTTGG - Intronic
960660460 3:120052468-120052490 TACTGTGGACTAGCTATTTTAGG - Intronic
964212994 3:154248671-154248693 GACTCTGGACCAGATTTTTTAGG + Intronic
965568101 3:170142828-170142850 GATGATGGTCTAGCTCTATTAGG + Intronic
967830891 3:193919306-193919328 CACTCTGGAATAGCTCTTTTGGG - Intergenic
969121824 4:4916533-4916555 GACTTTGGACTTGCACTTTTGGG - Intergenic
971561435 4:28083826-28083848 GACTTTGGACTTGGTCTGTTGGG - Intergenic
971652725 4:29300213-29300235 GTCTTTGGACTAGCTCTATTAGG + Intergenic
974742158 4:66021248-66021270 GACTCTGGACTTGAACTTTTGGG - Intergenic
981328119 4:143475932-143475954 GACTCTGGACCAGAACTGTTCGG - Intergenic
999414569 5:151383333-151383355 GACTCTAGAATGGTTCTATTTGG + Intergenic
999523163 5:152373711-152373733 GACTCTTTACTATCTCTAATTGG + Intergenic
999687333 5:154114896-154114918 GACTCTGGGCCAGCTCTCTGGGG - Intronic
1003416051 6:5909117-5909139 GAATATGGACTAGCTGTATCAGG - Intergenic
1003604173 6:7543673-7543695 GACTCTTTAGTAGCTCTTTTTGG + Intronic
1003789897 6:9534320-9534342 GACTCTGGACTATCTCTAGAAGG + Intergenic
1012617277 6:101292822-101292844 GACTCTGGACTTGGACTTTTGGG - Intergenic
1025038658 7:55619898-55619920 GACTTTGGACTTGCTTTTTTGGG + Intergenic
1030423463 7:109339667-109339689 GAGTCTAGATAAGCTCTATTGGG + Intergenic
1032030636 7:128480537-128480559 GAATCTGGCCTAACTGTATTAGG - Intronic
1059334363 9:113559455-113559477 GCCTCTGGGCTAGCTCTGTAGGG + Intronic
1188873035 X:35397924-35397946 GACTCTGGACTTGGACTTTTGGG - Intergenic
1189296875 X:39924744-39924766 GACTCTGGAGTGGCTTAATTGGG - Intergenic