ID: 1183887035

View in Genome Browser
Species Human (GRCh38)
Location 22:40892538-40892560
Sequence GGAGCCAGGCTAGGAGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183887035_1183887038 -9 Left 1183887035 22:40892538-40892560 CCAGTTGCTCCTAGCCTGGCTCC 0: 1
1: 0
2: 4
3: 25
4: 214
Right 1183887038 22:40892552-40892574 CCTGGCTCCTAATTCCACTAAGG 0: 1
1: 0
2: 0
3: 6
4: 125
1183887035_1183887042 12 Left 1183887035 22:40892538-40892560 CCAGTTGCTCCTAGCCTGGCTCC 0: 1
1: 0
2: 4
3: 25
4: 214
Right 1183887042 22:40892573-40892595 GGCTCTCTTATTTTGAGTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 144
1183887035_1183887041 11 Left 1183887035 22:40892538-40892560 CCAGTTGCTCCTAGCCTGGCTCC 0: 1
1: 0
2: 4
3: 25
4: 214
Right 1183887041 22:40892572-40892594 AGGCTCTCTTATTTTGAGTGTGG 0: 1
1: 0
2: 1
3: 21
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183887035 Original CRISPR GGAGCCAGGCTAGGAGCAAC TGG (reversed) Intronic
900322937 1:2093952-2093974 GGAGCCAGGCCAGCAGCTCCAGG + Intronic
901183184 1:7355786-7355808 GGAGCCAAGGGAGGAGCAAGAGG - Intronic
901239143 1:7682769-7682791 GGAGCCAGCCTAGGAGCGGCCGG - Intronic
902566521 1:17315037-17315059 GGAACCAGGCTGGGAGCAGGTGG + Intronic
902984700 1:20148474-20148496 GGAGCCAGGCCAGGAGCCTGAGG + Exonic
903272298 1:22197289-22197311 GGAGCCAGTCGGGGAGCAAAGGG - Intergenic
903324966 1:22564223-22564245 GGAGCCAGGCGCTGAGAAACGGG + Intronic
904947170 1:34207993-34208015 GGAACCAGGCCAGGAGAAGCAGG - Intronic
905005095 1:34703195-34703217 GGAGTCAGGGGAGGAGAAACAGG + Intergenic
905271501 1:36790560-36790582 GGAGCAAGCCAAGGAGCAGCAGG - Intergenic
906131476 1:43461170-43461192 GGAGCCAAGATAGAAGCCACAGG - Intergenic
907367681 1:53976059-53976081 GGAGCCGGGCTGGGGGCAACCGG + Intergenic
907372714 1:54013673-54013695 GGAGTCAGGGTAGGAACAATGGG - Intronic
914826883 1:151143427-151143449 GGAGCCAGGGAAGGAGCAGGGGG - Intronic
914875757 1:151511726-151511748 GGTGCCAGGCGAGGGGCACCTGG + Intronic
915305071 1:154972601-154972623 AGAGCCAGGGAAGGACCAACGGG + Intronic
915808160 1:158876736-158876758 TCTGCCAGGCTAGGAGCAGCAGG + Intergenic
918078365 1:181187727-181187749 GAAGCCAGAGTAAGAGCAACAGG + Intergenic
918618696 1:186577810-186577832 AGAGCAAGGCCAGGAGCCACAGG - Intergenic
920526763 1:206672859-206672881 GGAGGCAGGCTTGGAGGAAAGGG - Intronic
920923155 1:210315047-210315069 GGAGAAAGGCTAAGAGCAGCAGG - Intergenic
922241791 1:223760193-223760215 GGGGTCAGGCTAGGAAGAACAGG + Intronic
922472997 1:225888109-225888131 GCAGCCAGGCCAGGAGACACCGG + Intronic
922480999 1:225940079-225940101 GCAGCCAGGCCAGGAGACACCGG + Intronic
922739765 1:228008421-228008443 GGCGCCGGGCCAGGAGCAGCGGG + Intronic
923086744 1:230708237-230708259 AGAGCCAGGCCAGGAGGAAGAGG - Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1062811917 10:472842-472864 GGAGTCAGGATTAGAGCAACAGG + Intronic
1063382093 10:5591836-5591858 GGAGCAGGGCTAGCAGCAAAGGG + Intergenic
1067457103 10:46426894-46426916 CGAGCCAAGCTTGGAGCTACTGG + Intergenic
1067553078 10:47248659-47248681 GCAGCCGGGCTGGGAGCAGCTGG - Intergenic
1067630098 10:47957744-47957766 CGAGCCAAGCTTGGAGCTACTGG - Intergenic
1069584604 10:69589788-69589810 GGAGCCAGACTAGGAGCAGAAGG + Intergenic
1075308490 10:121390479-121390501 GGAGCAAGTTTAGGAGCAGCCGG - Intergenic
1075356773 10:121785414-121785436 GGTGCCAGGCTTGGAGAAACAGG + Intronic
1076515716 10:131043409-131043431 GGAGGCAGGCAAGGAGCAGCCGG - Intergenic
1076692418 10:132230619-132230641 GGAGCCTGGCTTGGGGCCACTGG + Intronic
1076734880 10:132454325-132454347 GGAGCCATCCCAGGAGCAATGGG + Intergenic
1077182794 11:1224034-1224056 GGGCCCAGGCTGGGAGCCACTGG - Intronic
1077426656 11:2482984-2483006 GGAGCCAGGCAGGGAGGAATGGG + Intronic
1080005771 11:27404807-27404829 GGAGACAGGCTATTTGCAACAGG + Intronic
1083740113 11:64705255-64705277 GGAGACAGGTAGGGAGCAACAGG + Intronic
1084153934 11:67303603-67303625 GGAGCCAGGCCGCGAGCACCTGG - Exonic
1088349113 11:108864949-108864971 GGGGTCAGGCTAAGAACAACAGG - Intronic
1090277879 11:125432364-125432386 GGAGCCAGGCTGGGAGCAAAGGG - Exonic
1091550682 12:1532655-1532677 GGAGCCAGGCTCGGAGGAGCTGG + Intronic
1091911252 12:4232357-4232379 GGGCCCAGGCTGGGAGAAACTGG + Intergenic
1093799496 12:23355901-23355923 GGAGCCAGGAGAGGAATAACTGG - Intergenic
1094342414 12:29427738-29427760 GAAGCCAGGAGAGTAGCAACAGG + Intronic
1097866970 12:64567131-64567153 GGAGCCAGGCTGGGAGACAAAGG + Intergenic
1099558093 12:84136384-84136406 GGAGAAAGGCTAGAAGGAACTGG - Intergenic
1101817489 12:108156866-108156888 TGAGCCAAGCTTGGAGCAACAGG + Intronic
1101850061 12:108394536-108394558 GAAGCCAGGCTTGGAGAGACTGG - Intergenic
1102884106 12:116508702-116508724 GGAGCCAGGCTCCGCGCACCAGG + Intergenic
1106478072 13:30114957-30114979 AGAGCCAGGCGACGAGCGACGGG - Intergenic
1108574412 13:51779155-51779177 TGAGCTGGGCAAGGAGCAACTGG - Intronic
1111861805 13:93716982-93717004 GTTTTCAGGCTAGGAGCAACAGG + Intronic
1113609485 13:111633126-111633148 GGAGCCACTCTGGGAGCAGCCGG - Intronic
1114356250 14:21912394-21912416 GGAGTCAGGCTAGCAGGACCAGG + Intergenic
1117340860 14:54789999-54790021 GGAGCAAGGCTGGGAGTGACAGG - Exonic
1118318644 14:64740734-64740756 GCAGCCAGCCTAGGAGCTACAGG - Intronic
1120867103 14:89304722-89304744 GGGGCCAGACGAGGAGCAGCCGG - Intronic
1121655042 14:95588756-95588778 GGAGTCAGGCAAGGAGCACAAGG + Intergenic
1121947336 14:98136027-98136049 TGAGCCAGGCAGGGAGCTACAGG - Intergenic
1123700090 15:22907805-22907827 GGAGCCAGGGCCGGAGCCACAGG - Intronic
1126090562 15:45047711-45047733 GGAGCCAGGAAAGGACCCACAGG - Intronic
1127762561 15:62153082-62153104 GGAGGCAGCCTGGGAGTAACTGG - Intergenic
1130228470 15:82078323-82078345 AGAACCAGTCTAGGAGCATCTGG + Intergenic
1131622581 15:94083107-94083129 GGAGCCAGGATTGGAGCATGGGG - Intergenic
1132616013 16:841508-841530 GGAGCGTGGCTAGGGGCACCAGG - Intergenic
1135221307 16:20616222-20616244 GGAGCCAGCCCAGGGACAACTGG - Intronic
1136062821 16:27738263-27738285 GGAGCCAGGGAAGGAGGAAGGGG + Intronic
1136071225 16:27788468-27788490 GGAGCCAGGCCAGGAGGAACTGG - Exonic
1136173798 16:28504021-28504043 GGAGCAAGGGAAGCAGCAACAGG + Exonic
1136999424 16:35216290-35216312 GGAGCCAGGCAGGGAGCCAGAGG + Intergenic
1137003528 16:35251716-35251738 GGAGCCAGGCAGGGAGCCAGAGG - Intergenic
1137036026 16:35570667-35570689 CGAGCCAGGCTTAGAGAAACAGG - Intergenic
1139514968 16:67447428-67447450 GAAGCCAGGCAAGGAGGAAGAGG - Intronic
1141014328 16:80434165-80434187 GAAGCCTGACTAGGAGCATCAGG - Intergenic
1142185292 16:88692032-88692054 GGAGCCAGCCAAGAAGCACCAGG + Intergenic
1142263189 16:89051975-89051997 CAAGCCAGGCTGGGAGCAAGAGG + Intergenic
1143410440 17:6705185-6705207 GGACCCAGGCTAGGAGGAGGGGG + Intronic
1144501657 17:15792920-15792942 GGATCCAGGCTGGGATGAACTGG - Intergenic
1145163836 17:20595579-20595601 GGATCCAGGCTGGGATGAACTGG - Intergenic
1145403711 17:22568695-22568717 GCAGCCTGGCTTGGAGCAGCTGG + Intergenic
1147400290 17:40176942-40176964 GGAGCCAGGCAGGGAGCAGCAGG - Intergenic
1147524679 17:41210473-41210495 GCAGCCAGGCTAGAAGCCTCAGG - Intronic
1148073008 17:44919611-44919633 TGAGCCAGGCTAGGAGGATGGGG - Intergenic
1149535605 17:57431242-57431264 GGAGCCTGGCTCTGAGCATCAGG - Intronic
1149846973 17:60014004-60014026 GGACCCATGGTAGGAGCCACGGG - Intergenic
1150085329 17:62270611-62270633 GGACCCATGGTAGGAGCCACGGG - Intergenic
1151185704 17:72362492-72362514 TGAGACAGGCTAGGAGCAATGGG + Intergenic
1151416921 17:73972608-73972630 GCAGCCAGACCAGGAGCCACCGG - Intergenic
1152579188 17:81158585-81158607 GGAGCCAGGCTCGGGGCAGTGGG - Intronic
1153279307 18:3399170-3399192 GTAGCCAGGCTGGAAGCAAAAGG - Intergenic
1156825048 18:41420613-41420635 GGAGGCAGGTTAGGAGTTACAGG - Intergenic
1157411187 18:47464847-47464869 GGACCCAGCCTCGGAGGAACAGG + Intergenic
1159378071 18:67620119-67620141 GGATCTAGGCTAGGAGGATCCGG - Intergenic
1160471028 18:79133878-79133900 GGAGCCAGGCCAGGAGCTGCAGG - Intronic
1160716057 19:577316-577338 GGAGCCGGGCTAGGGGCTTCTGG + Intronic
1160822739 19:1066092-1066114 AGAGCCAGACTTGGAGCAAGGGG + Exonic
1161349664 19:3784854-3784876 GGTGCCAGGCTCGGAGGAAGCGG + Exonic
1162337547 19:10071139-10071161 GGTGCCAGGCGAGGAGAGACCGG + Intergenic
1162524007 19:11197190-11197212 GGAGCCAAGACAGGAGAAACGGG + Intronic
1167736235 19:51296132-51296154 TGAGCCAGGCAAGGGGCCACAGG + Intergenic
1167880490 19:52453586-52453608 GGAGCCGGTCTTGGAGCAGCGGG + Exonic
1168153147 19:54459755-54459777 TGAGCCAGGGTAGGAGTCACAGG + Intronic
1168528253 19:57105886-57105908 GGTGCGAGGCTAGGAGCAGCAGG + Intergenic
926059499 2:9796310-9796332 GCAGCCAGGCTGGGAACCACAGG - Intergenic
926684830 2:15690620-15690642 AGAGCCTGGCTCGGAGCACCTGG - Intergenic
931690698 2:64832443-64832465 GGAGCAAGGCTAGGGTCAGCAGG + Intergenic
933770796 2:85742685-85742707 GCAGCCAGCCCGGGAGCAACTGG + Intergenic
934591241 2:95551712-95551734 GCAGCAATACTAGGAGCAACGGG + Intergenic
934766976 2:96885161-96885183 GGAGACAGGCTGGCAGCAGCTGG + Intronic
937368416 2:121281572-121281594 AGAGACAGGCTAGCAGCAAAGGG + Intronic
938063455 2:128269089-128269111 GGAGCCAGGCCAGGCGCTGCAGG - Intronic
938185108 2:129224666-129224688 GGACACAGGCTAGGAGCAGATGG + Intergenic
941380263 2:164784033-164784055 GGAGCCAGGCCAGGAGAAGGAGG + Intronic
943774142 2:191746902-191746924 GCAGCCAGGCTTAGAGGAACAGG + Intergenic
945964885 2:216175991-216176013 AGAGTCAGCCTAGGGGCAACCGG + Intronic
948048070 2:234958616-234958638 GGAGCCAGTGGAGGAGCAGCTGG + Intronic
948703835 2:239777465-239777487 GCAGCCGGGCTAGGGGCACCAGG - Intronic
948893424 2:240917623-240917645 GGAGCCAGGCAAGGAGGACTTGG + Intergenic
949041589 2:241852228-241852250 GGACCCAGACTAGCAGCACCAGG + Exonic
1168902784 20:1379312-1379334 GGTACCAGGCTAGGAGCACTAGG + Intronic
1170469231 20:16651943-16651965 GGAGACAGGCTAGGAGTGATTGG - Intergenic
1172485253 20:35294031-35294053 GGAGCCAGGCTAGGCAGAAGCGG + Intergenic
1172968395 20:38855698-38855720 GGAGCCAGGAGAGCTGCAACAGG + Intronic
1173606907 20:44337946-44337968 GGAGGCAGGCTTGGAGCAGTGGG + Intronic
1174085741 20:48006133-48006155 TGAGCCAGGCTAAGAGCAGCAGG - Intergenic
1175740692 20:61417856-61417878 GGGGCCAGGCCAGGAGCAGCAGG + Intronic
1175871737 20:62212543-62212565 GGAGCCAGGCTGGGTGGTACTGG + Intergenic
1177771941 21:25526748-25526770 GGAGACAGGCTAGGAGTAGTAGG - Intergenic
1179437974 21:41375085-41375107 GGAGCAAGGCTTGGAGGAAGTGG - Intronic
1179991616 21:44951160-44951182 GGAGCCAGGCCATGAGACACAGG - Intronic
1179991788 21:44952153-44952175 GGAGCCAGGCCATGAGACACAGG - Intronic
1180559293 22:16602232-16602254 GGAGCCAGGCCGGGAGCCAGCGG + Intergenic
1180802145 22:18636899-18636921 TGAGCCAGGTGAGGAGCCACCGG - Intergenic
1180853383 22:19032451-19032473 TGAGCCAGGTGAGGAGCCACCGG - Intergenic
1181022302 22:20109871-20109893 GATGCCAGGCTAGGAGGAGCAGG - Intronic
1181035225 22:20166739-20166761 GGAACCAGGATTGGAGAAACTGG - Intergenic
1181219577 22:21358360-21358382 TGAGCCAGGTGAGGAGCCACCGG + Intergenic
1182163906 22:28152392-28152414 GGAGCCATGCTAGGATTACCTGG - Intronic
1182550002 22:31095770-31095792 GGAGCTAGGGAAGGAGCAGCTGG - Intronic
1183887035 22:40892538-40892560 GGAGCCAGGCTAGGAGCAACTGG - Intronic
1183982473 22:41549671-41549693 GGGGCCAGGCTGGGGGCAAGGGG + Intergenic
1184320458 22:43738831-43738853 GGAGCCAGGCCAGCTGCAAGTGG - Intronic
1184878791 22:47291993-47292015 GGAGCAAGGCTAGGAGGGAGGGG + Intergenic
1185031322 22:48444696-48444718 ACAGCCAGGCCAGGAGCCACTGG + Intergenic
950477628 3:13223961-13223983 GGAGCCAGGCTCTGAGCCAGGGG + Intergenic
950668451 3:14511276-14511298 GGAGCCAGGCGACAAGCTACTGG - Exonic
951190670 3:19766560-19766582 GAAGCCAGGATGGGAGCACCTGG - Intergenic
953002371 3:38947672-38947694 GGAGTCATGCTAGGAGAAAATGG - Intronic
953403205 3:42644875-42644897 GGAGCCACAGTAGGAGCAAAGGG - Intronic
953470098 3:43159054-43159076 GGACACAGGCTAGCAGCAAGGGG + Intergenic
953913631 3:46904978-46905000 AGAGCCAGGCTGGGAGCCACTGG + Intergenic
954580932 3:51702572-51702594 GGAGCCAAGCCAGGTGCAGCTGG - Intronic
954603242 3:51888723-51888745 GGAGCCAGGCTGGGCTCAAATGG + Intergenic
954706258 3:52482242-52482264 GGAATCAGGCTGGAAGCAACAGG - Intronic
954955845 3:54517786-54517808 GGAGGCAGGGTTGGAGCAACAGG - Intronic
961076770 3:123990134-123990156 GGAGCCAGGTTAGGAGAATATGG + Intronic
962048791 3:131790445-131790467 AGAGCCAGGCAAGGAGTGACTGG - Intronic
962137981 3:132757275-132757297 GGAGGCAGCCGAGAAGCAACAGG - Intergenic
964054201 3:152432786-152432808 GGGACCAGGCTTGGAGAAACAGG - Exonic
964229490 3:154447553-154447575 GTTGGCAGCCTAGGAGCAACAGG + Intergenic
967584998 3:191202383-191202405 TGAACCAGGCTGTGAGCAACAGG + Intronic
968736079 4:2297202-2297224 GGAGCCAGGCTGGGGGCCACAGG + Intronic
969483669 4:7459903-7459925 GGAGAGAGGCAAGGAGCAGCTGG + Intronic
970177873 4:13357407-13357429 GGAGCCAGCCTAACAGCCACAGG + Intergenic
970401031 4:15718059-15718081 GGAGCCAGGCTGGCAGGAGCAGG - Intronic
983008264 4:162512661-162512683 GGAGACAGGATAGGAGAAAAGGG - Intergenic
983801277 4:171932504-171932526 GGAGCCAGGTTGGAAGCAGCGGG + Intronic
985359583 4:189158382-189158404 AGAGCCAGGAGAGGAGCAAATGG - Intergenic
985652341 5:1112728-1112750 GGAGCCAGGCTAGGAGCCCAGGG - Intergenic
985733608 5:1565066-1565088 GGAGCCAGGCCAGGAGCAAGAGG - Intergenic
985991293 5:3563980-3564002 GGAAACATTCTAGGAGCAACTGG - Intergenic
990458207 5:56009265-56009287 GGGGCCAGGCTCGGATCAAGGGG + Intergenic
990920348 5:60957993-60958015 GGAGCAAGGCTAAGAGCAAGTGG - Intronic
991295068 5:65071760-65071782 GGAGCCAGGGTGGAAGCAGCAGG + Intergenic
995921020 5:117312307-117312329 GGAGCCTGGGTAGGAGAGACAGG - Intergenic
997642222 5:135456710-135456732 GGAGCCAGGCTGAGTGAAACCGG - Intergenic
999063009 5:148655143-148655165 GGAGGCAGGCAGGGAGCAAAGGG + Intronic
1001396330 5:171421402-171421424 GGGGCCAGGCCAGGAGGAACTGG + Intronic
1001666046 5:173434567-173434589 GGAGCCAAGCCAGGGGAAACGGG - Intergenic
1002072906 5:176691088-176691110 GGACTCTGGCCAGGAGCAACAGG + Intergenic
1003567379 6:7232003-7232025 GAAGCCAAGCTAGGAATAACTGG - Intronic
1004577309 6:16909599-16909621 GGAGCCAGAGTAGGAGAAATGGG + Intergenic
1005131521 6:22513946-22513968 GGAGCCAGGCTAGAAGGAACGGG + Intergenic
1005769385 6:29051182-29051204 GGAGCCAGGCAAGGTGCATCTGG - Intergenic
1005988759 6:30890714-30890736 GGAGCCAGGCAAGGAGAAGAGGG + Intronic
1005989875 6:30896170-30896192 GGAGCCAGGCTGAAAGCCACGGG + Intronic
1006183609 6:32168298-32168320 GGAGGTAGGCTGGGAGCAAAAGG - Exonic
1006445238 6:34076355-34076377 CAGGCCAGGCTAGGAGCAAGGGG + Intronic
1007231360 6:40349541-40349563 GGAGCCAGCCAAGGAGCCTCTGG - Intergenic
1007427770 6:41758269-41758291 CGGGTCAGGGTAGGAGCAACAGG - Intergenic
1007925314 6:45645212-45645234 GGAGCCAGCCTTGGAGGAGCTGG + Intronic
1010750352 6:79610704-79610726 GGAGCCAGATCAGGAGCATCAGG - Intergenic
1015750463 6:136553349-136553371 GGAGCCAGGGCAGGAAGAACAGG - Intergenic
1018630716 6:165819617-165819639 GAAACCAGGGGAGGAGCAACCGG - Intronic
1019024712 6:168949443-168949465 GGAGCCAGGCTAGGGGGAGCAGG - Intergenic
1019184404 6:170212698-170212720 GGAGGCAGGCTGAGAGCATCCGG - Intergenic
1024226395 7:47329332-47329354 GGAGGCAGCCCAGGAGGAACGGG - Intronic
1024275633 7:47674534-47674556 AGAGCCAGGCTCTGAGCAGCAGG + Intergenic
1024299255 7:47874125-47874147 GGGGCCAGGCTCCGAGCCACAGG + Intronic
1029270172 7:99372895-99372917 GAAGCCAGGGAAGCAGCAACAGG + Intronic
1029597134 7:101543926-101543948 GGGGCCAGGCCTGGAGCCACTGG + Intronic
1030149120 7:106385180-106385202 GAAGCCAGGCTAGCAGTAAGGGG + Intergenic
1030284561 7:107812532-107812554 GTGGCAAGGATAGGAGCAACTGG - Intergenic
1033258102 7:139819127-139819149 GGAGCCAGCCCAGGAGGAAAAGG - Intronic
1034470674 7:151252732-151252754 GAAGCCAGGCCAGGGGCATCAGG + Intronic
1034617952 7:152435587-152435609 GGAGCCAGGCCGGGAGCCAGCGG - Intronic
1036625043 8:10463625-10463647 GGTGCCAGGGTAGGAACTACTGG - Intergenic
1038369446 8:26973291-26973313 GGTGCCAAGCAAGGAGCACCAGG - Intergenic
1038561923 8:28588263-28588285 GGAGCCAGGCTAGCAGAACAGGG - Intergenic
1039363263 8:36903110-36903132 GAAGCCAGGGTAGGGGGAACGGG - Intronic
1039743646 8:40404562-40404584 GGTGCCAGGCAAGGAGGACCAGG + Intergenic
1040491695 8:47929238-47929260 GAAGACAGGCTAGGAACTACTGG - Intronic
1040702248 8:50080524-50080546 GGAGCCAGTAAAGGAGAAACAGG - Intronic
1040825065 8:51611868-51611890 GGAGCGAGGCCAGGAGCAGCCGG + Intronic
1041856592 8:62462804-62462826 TGAACCAGGCTGAGAGCAACTGG + Intronic
1042784946 8:72536881-72536903 GGAGCCAGGCCCGGGGCAGCAGG + Intergenic
1047307784 8:123666995-123667017 AGAGCCCAGCTAGGAGCAACAGG - Intergenic
1047841313 8:128755822-128755844 GGAGCCAATCTTGGAGAAACAGG + Intergenic
1048549618 8:135422204-135422226 GCAGTCAGGCTTGGAGCAGCAGG - Intergenic
1048893950 8:138971948-138971970 GTAGCCAAGCCAGGAGAAACGGG - Intergenic
1049288176 8:141787825-141787847 GGAGCAAGGGTCGGAGCCACGGG - Intergenic
1049578835 8:143401616-143401638 GGAGGCAGGGTGGGAGAAACAGG + Intergenic
1049760249 8:144328980-144329002 AGAGCCAGGCTTGGAGCCAATGG + Intergenic
1054826909 9:69582541-69582563 GGTACCAGGCTAGAAGAAACTGG - Intronic
1056378336 9:86035545-86035567 GGAGCCAGGCCGGGAGCAGGTGG - Exonic
1056580721 9:87886749-87886771 GGACCCAGACAAGGAGCATCTGG + Exonic
1057035801 9:91811066-91811088 GGAGGCTGGCTAGGAGGAAAAGG + Intronic
1057984890 9:99702984-99703006 GGAGCCTGGCTAGCAGCCCCTGG - Intergenic
1058467738 9:105245260-105245282 GGAGCCAGGCCCGGAAGAACAGG - Intronic
1059423931 9:114209279-114209301 GGAGCCATGGCAGGAGCCACGGG + Intronic
1060267781 9:122122236-122122258 GAAGCCAGGGCAGGAGCAAGAGG - Intergenic
1061180764 9:129023808-129023830 GGAGGGAGGCCAGGAGCAGCTGG - Intronic
1061869113 9:133510922-133510944 GGAGCCAGGTAGGGAGCACCCGG - Intergenic
1062390297 9:136331180-136331202 GGAGCCAGGCTAGGGGAACGTGG + Intronic
1186705866 X:12138693-12138715 GGAGCCAGGCAGGGCGCAAGAGG - Exonic
1187779106 X:22797432-22797454 GAGGCCAGGATAGGAGCAACAGG - Intergenic
1192563564 X:72143902-72143924 GGAGCCAGGGATGGAGCAGCCGG - Intergenic
1193658428 X:84225889-84225911 GGAGCCAAGCTAGGAATAAAGGG + Intergenic
1197847044 X:130813971-130813993 GGAGCCAAGCTAAGATCCACTGG + Intronic