ID: 1183903315

View in Genome Browser
Species Human (GRCh38)
Location 22:41022065-41022087
Sequence CCCGGGGGCGCGCGCCGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183903295_1183903315 15 Left 1183903295 22:41022027-41022049 CCGCCCAGGGCTGGGCCGGAGGG No data
Right 1183903315 22:41022065-41022087 CCCGGGGGCGCGCGCCGCTGGGG No data
1183903299_1183903315 12 Left 1183903299 22:41022030-41022052 CCCAGGGCTGGGCCGGAGGGGGA No data
Right 1183903315 22:41022065-41022087 CCCGGGGGCGCGCGCCGCTGGGG No data
1183903286_1183903315 30 Left 1183903286 22:41022012-41022034 CCAAGGGCGTCTGCCCCGCCCAG No data
Right 1183903315 22:41022065-41022087 CCCGGGGGCGCGCGCCGCTGGGG No data
1183903300_1183903315 11 Left 1183903300 22:41022031-41022053 CCAGGGCTGGGCCGGAGGGGGAG No data
Right 1183903315 22:41022065-41022087 CCCGGGGGCGCGCGCCGCTGGGG No data
1183903293_1183903315 16 Left 1183903293 22:41022026-41022048 CCCGCCCAGGGCTGGGCCGGAGG No data
Right 1183903315 22:41022065-41022087 CCCGGGGGCGCGCGCCGCTGGGG No data
1183903306_1183903315 0 Left 1183903306 22:41022042-41022064 CCGGAGGGGGAGGGGGCGGACAC No data
Right 1183903315 22:41022065-41022087 CCCGGGGGCGCGCGCCGCTGGGG No data
1183903292_1183903315 17 Left 1183903292 22:41022025-41022047 CCCCGCCCAGGGCTGGGCCGGAG No data
Right 1183903315 22:41022065-41022087 CCCGGGGGCGCGCGCCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183903315 Original CRISPR CCCGGGGGCGCGCGCCGCTG GGG Intergenic
No off target data available for this crispr