ID: 1183904705

View in Genome Browser
Species Human (GRCh38)
Location 22:41031742-41031764
Sequence CTTTCCCCTAGCACAGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183904699_1183904705 2 Left 1183904699 22:41031717-41031739 CCAGGTAATGGGAATCCCTCTAC No data
Right 1183904705 22:41031742-41031764 CTTTCCCCTAGCACAGGGTTGGG No data
1183904694_1183904705 28 Left 1183904694 22:41031691-41031713 CCTTTCATGAGAACTTTGCATGG No data
Right 1183904705 22:41031742-41031764 CTTTCCCCTAGCACAGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183904705 Original CRISPR CTTTCCCCTAGCACAGGGTT GGG Intergenic
No off target data available for this crispr