ID: 1183906978

View in Genome Browser
Species Human (GRCh38)
Location 22:41049078-41049100
Sequence CAGAGAGAGCAGAGGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183906976_1183906978 -4 Left 1183906976 22:41049059-41049081 CCTGCTCATGCTGGTTTCACAGA No data
Right 1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183906978 Original CRISPR CAGAGAGAGCAGAGGCAAGA TGG Intergenic
No off target data available for this crispr