ID: 1183908358

View in Genome Browser
Species Human (GRCh38)
Location 22:41060064-41060086
Sequence CTGGATAAAAAGATTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183908358_1183908363 8 Left 1183908358 22:41060064-41060086 CCCTGCAGAATCTTTTTATCCAG No data
Right 1183908363 22:41060095-41060117 ACACCCTGAGGCTGACACACAGG No data
1183908358_1183908361 -4 Left 1183908358 22:41060064-41060086 CCCTGCAGAATCTTTTTATCCAG No data
Right 1183908361 22:41060083-41060105 CCAGCTTAGACCACACCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183908358 Original CRISPR CTGGATAAAAAGATTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr