ID: 1183910116

View in Genome Browser
Species Human (GRCh38)
Location 22:41072690-41072712
Sequence TCTCACACACTGAGAGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183910114_1183910116 1 Left 1183910114 22:41072666-41072688 CCAGTGAAGTGGAGCAGTGGGAA No data
Right 1183910116 22:41072690-41072712 TCTCACACACTGAGAGTAGAGGG No data
1183910111_1183910116 11 Left 1183910111 22:41072656-41072678 CCAAATATTGCCAGTGAAGTGGA No data
Right 1183910116 22:41072690-41072712 TCTCACACACTGAGAGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183910116 Original CRISPR TCTCACACACTGAGAGTAGA GGG Intergenic
No off target data available for this crispr