ID: 1183910116 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:41072690-41072712 |
| Sequence | TCTCACACACTGAGAGTAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1183910114_1183910116 | 1 | Left | 1183910114 | 22:41072666-41072688 | CCAGTGAAGTGGAGCAGTGGGAA | No data | ||
| Right | 1183910116 | 22:41072690-41072712 | TCTCACACACTGAGAGTAGAGGG | No data | ||||
| 1183910111_1183910116 | 11 | Left | 1183910111 | 22:41072656-41072678 | CCAAATATTGCCAGTGAAGTGGA | No data | ||
| Right | 1183910116 | 22:41072690-41072712 | TCTCACACACTGAGAGTAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1183910116 | Original CRISPR | TCTCACACACTGAGAGTAGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||